Incidental Mutation 'R4366:Tlr1'
ID325747
Institutional Source Beutler Lab
Gene Symbol Tlr1
Ensembl Gene ENSMUSG00000044827
Gene Nametoll-like receptor 1
Synonyms
MMRRC Submission 041114-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4366 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location64924679-64933563 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 64925837 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 466 (D466N)
Ref Sequence ENSEMBL: ENSMUSP00000142500 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059349] [ENSMUST00000197315]
Predicted Effect probably benign
Transcript: ENSMUST00000059349
AA Change: D466N

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000060793
Gene: ENSMUSG00000044827
AA Change: D466N

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
LRR 71 94 5.72e0 SMART
LRR 116 140 3.27e2 SMART
low complexity region 240 256 N/A INTRINSIC
LRR 374 397 9.75e0 SMART
LRR 400 423 4.98e1 SMART
low complexity region 427 438 N/A INTRINSIC
LRR 448 469 6.23e1 SMART
LRR 470 494 4.57e0 SMART
LRRCT 527 581 2.5e-11 SMART
transmembrane domain 583 605 N/A INTRINSIC
TIR 639 782 4.03e-41 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000197315
AA Change: D466N

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000142500
Gene: ENSMUSG00000044827
AA Change: D466N

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
LRR 71 94 5.72e0 SMART
Pfam:LRR_1 97 114 2.3e-2 PFAM
LRR 116 140 3.27e2 SMART
low complexity region 240 256 N/A INTRINSIC
LRR 374 397 9.75e0 SMART
LRR 400 423 4.98e1 SMART
low complexity region 427 438 N/A INTRINSIC
LRR 448 469 6.23e1 SMART
LRR 470 494 4.57e0 SMART
LRRCT 527 581 2.5e-11 SMART
transmembrane domain 583 605 N/A INTRINSIC
TIR 639 782 4.03e-41 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.7%
Validation Efficiency 95% (57/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Toll-like receptor (TLR) family which plays a fundamental role in pathogen recognition and activation of innate immunity. TLRs are highly conserved from Drosophila to humans and share structural and functional similarities. They recognize pathogen-associated molecular patterns (PAMPs) that are expressed on infectious agents, and mediate the production of cytokines necessary for the development of effective immunity. The various TLRs exhibit different patterns of expression. This gene is ubiquitously expressed, and at higher levels than other TLR genes. Different length transcripts presumably resulting from use of alternative polyadenylation site, and/or from alternative splicing, have been noted for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display decreased macrophage peptoglycan-stimulated IL-6 production. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf5 A C 17: 43,441,969 T396P probably damaging Het
Apob A T 12: 8,016,083 I4318F possibly damaging Het
Apol7c T G 15: 77,526,389 D119A probably benign Het
App G T 16: 85,056,433 D252E unknown Het
C4a T A 17: 34,814,908 noncoding transcript Het
Cacna1b T C 2: 24,702,620 Y515C probably damaging Het
Cacna1f G T X: 7,609,974 A123S probably damaging Het
Cldn6 G C 17: 23,681,520 A153P probably benign Het
Cmya5 T C 13: 93,091,956 N2208S probably benign Het
Csnk1g1 A G 9: 66,019,853 T101A probably benign Het
Ddx46 T A 13: 55,663,236 D544E probably benign Het
Dmxl1 T A 18: 49,878,017 C1080* probably null Het
Dst T C 1: 34,251,878 S3335P probably damaging Het
Efnb3 T C 11: 69,555,945 K313R probably damaging Het
Elf2 G A 3: 51,308,149 Q47* probably null Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Epc2 A G 2: 49,547,554 K657E possibly damaging Het
Ephx4 A G 5: 107,403,813 probably benign Het
Ereg T C 5: 91,086,800 I24T probably benign Het
Evc2 C A 5: 37,338,669 A41D possibly damaging Het
Fkbp15 A G 4: 62,336,414 V283A probably benign Het
Flrt3 T C 2: 140,660,407 T434A probably damaging Het
Gm572 A G 4: 148,654,865 D50G possibly damaging Het
Hecw1 C T 13: 14,316,164 D748N probably damaging Het
Hivep3 A C 4: 120,096,089 H534P possibly damaging Het
Hspa4l C A 3: 40,766,809 probably null Het
Ipo7 T C 7: 110,029,712 M63T possibly damaging Het
Ipo7 A T 7: 110,048,216 T614S possibly damaging Het
Krt83 T G 15: 101,487,514 M326L probably benign Het
Mbd5 T A 2: 49,272,966 N261K probably damaging Het
Mcam T A 9: 44,134,697 L3Q probably damaging Het
Mcoln3 C A 3: 146,140,492 T519K possibly damaging Het
Mrgprx1 C A 7: 48,021,193 A269S probably damaging Het
Mypn T C 10: 63,192,708 E192G probably benign Het
Nup205 C A 6: 35,192,027 P397Q probably benign Het
Obsl1 A C 1: 75,488,049 L1576R possibly damaging Het
Ofcc1 A G 13: 40,015,461 S817P probably benign Het
Olfr800 A T 10: 129,660,531 M242L probably benign Het
Olfr876 A T 9: 37,804,190 H93L probably benign Het
Pcdhgb7 A G 18: 37,754,072 Y765C possibly damaging Het
Pde7a A G 3: 19,310,862 probably null Het
Phip C T 9: 82,900,869 probably benign Het
Rhbdl2 T A 4: 123,809,935 M1K probably null Het
Ripor2 C T 13: 24,721,711 P947S probably benign Het
Sf3a3 A G 4: 124,725,139 T298A probably benign Het
Slc25a29 C T 12: 108,831,171 probably benign Het
Spinkl T G 18: 44,174,583 T4P possibly damaging Het
Stk33 G A 7: 109,279,795 S449L probably benign Het
Suz12 T A 11: 80,002,162 probably benign Het
Timp2 T A 11: 118,310,671 I124F probably damaging Het
Tmem200b A G 4: 131,922,470 I234V possibly damaging Het
Ubr1 C A 2: 120,970,603 probably benign Het
Usp33 C A 3: 152,368,512 Q332K probably benign Het
Zfr A G 15: 12,156,330 E634G probably damaging Het
Other mutations in Tlr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00571:Tlr1 APN 5 64926434 missense probably benign 0.01
IGL01324:Tlr1 APN 5 64925179 missense probably damaging 1.00
IGL01564:Tlr1 APN 5 64925846 missense probably damaging 1.00
IGL01663:Tlr1 APN 5 64925073 missense possibly damaging 0.48
IGL01689:Tlr1 APN 5 64925779 missense probably damaging 0.97
IGL01749:Tlr1 APN 5 64925947 nonsense probably null
IGL01751:Tlr1 APN 5 64925947 nonsense probably null
IGL01769:Tlr1 APN 5 64925947 nonsense probably null
IGL01899:Tlr1 APN 5 64927016 missense probably damaging 0.97
IGL02197:Tlr1 APN 5 64926454 missense probably damaging 1.00
IGL02295:Tlr1 APN 5 64925947 nonsense probably null
IGL02308:Tlr1 APN 5 64925947 nonsense probably null
IGL02309:Tlr1 APN 5 64925947 nonsense probably null
IGL02311:Tlr1 APN 5 64925947 nonsense probably null
IGL02591:Tlr1 APN 5 64926716 missense probably damaging 1.00
IGL02739:Tlr1 APN 5 64927126 missense probably benign 0.41
IGL03206:Tlr1 APN 5 64925057 missense probably damaging 0.99
IGL03055:Tlr1 UTSW 5 64926596 missense probably benign 0.05
R0315:Tlr1 UTSW 5 64926928 missense probably damaging 0.99
R0317:Tlr1 UTSW 5 64925967 nonsense probably null
R0511:Tlr1 UTSW 5 64926620 missense probably damaging 0.98
R1539:Tlr1 UTSW 5 64926976 missense probably damaging 1.00
R1552:Tlr1 UTSW 5 64926860 missense probably damaging 1.00
R1835:Tlr1 UTSW 5 64925700 missense probably benign 0.01
R1933:Tlr1 UTSW 5 64925438 missense possibly damaging 0.94
R1956:Tlr1 UTSW 5 64925177 missense probably damaging 1.00
R2099:Tlr1 UTSW 5 64925068 missense probably damaging 1.00
R2507:Tlr1 UTSW 5 64925296 missense probably damaging 1.00
R2508:Tlr1 UTSW 5 64925296 missense probably damaging 1.00
R2937:Tlr1 UTSW 5 64925908 missense probably damaging 0.96
R2938:Tlr1 UTSW 5 64925908 missense probably damaging 0.96
R3033:Tlr1 UTSW 5 64925569 missense probably damaging 1.00
R4164:Tlr1 UTSW 5 64927202 missense possibly damaging 0.47
R4226:Tlr1 UTSW 5 64925717 missense probably damaging 0.96
R5009:Tlr1 UTSW 5 64926224 missense probably damaging 1.00
R5029:Tlr1 UTSW 5 64925681 missense probably damaging 0.97
R5069:Tlr1 UTSW 5 64926400 missense probably benign 0.01
R5186:Tlr1 UTSW 5 64925221 missense probably damaging 1.00
R5336:Tlr1 UTSW 5 64925802 missense probably damaging 1.00
R5500:Tlr1 UTSW 5 64927098 missense probably benign 0.08
R5503:Tlr1 UTSW 5 64926292 missense probably damaging 0.99
R5577:Tlr1 UTSW 5 64926085 missense possibly damaging 0.94
R6141:Tlr1 UTSW 5 64925213 missense possibly damaging 0.92
R6210:Tlr1 UTSW 5 64925286 missense probably damaging 1.00
R6238:Tlr1 UTSW 5 64927129 missense possibly damaging 0.86
R6284:Tlr1 UTSW 5 64927099 missense possibly damaging 0.93
R6311:Tlr1 UTSW 5 64926845 missense probably damaging 0.99
R7021:Tlr1 UTSW 5 64925713 missense possibly damaging 0.75
R7140:Tlr1 UTSW 5 64925678 missense probably benign 0.01
R7234:Tlr1 UTSW 5 64926724 missense probably damaging 0.96
R7278:Tlr1 UTSW 5 64926772 missense probably benign 0.03
R7378:Tlr1 UTSW 5 64925228 missense not run
R7652:Tlr1 UTSW 5 64926787 nonsense probably null
R7781:Tlr1 UTSW 5 64926736 missense possibly damaging 0.94
R7783:Tlr1 UTSW 5 64924921 missense probably damaging 1.00
R7851:Tlr1 UTSW 5 64924964 missense possibly damaging 0.58
R7934:Tlr1 UTSW 5 64924964 missense possibly damaging 0.58
X0067:Tlr1 UTSW 5 64926575 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCAGCCTATGTTCTTGACAAAG -3'
(R):5'- CCAGAATTCTCTAAGGTACAGCG -3'

Sequencing Primer
(F):5'- CTCAGCTCACATGTGCATTGGAATG -3'
(R):5'- ATTCTCTAAGGTACAGCGATGGG -3'
Posted On2015-07-06