Incidental Mutation 'R4366:Ephx4'
ID325749
Institutional Source Beutler Lab
Gene Symbol Ephx4
Ensembl Gene ENSMUSG00000033805
Gene Nameepoxide hydrolase 4
SynonymsLOC384214, Abhd7
MMRRC Submission 041114-MU
Accession Numbers

Genbank: NM_001001804

Is this an essential gene? Probably non essential (E-score: 0.218) question?
Stock #R4366 (G1)
Quality Score196
Status Validated
Chromosome5
Chromosomal Location107402736-107430035 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 107403813 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124661 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049146] [ENSMUST00000159968] [ENSMUST00000161246] [ENSMUST00000161452]
Predicted Effect probably benign
Transcript: ENSMUST00000049146
SMART Domains Protein: ENSMUSP00000043764
Gene: ENSMUSG00000033805

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:Hydrolase_4 88 203 2.4e-11 PFAM
Pfam:Abhydrolase_1 92 341 6.6e-27 PFAM
Pfam:Abhydrolase_5 93 335 5.7e-15 PFAM
Pfam:Abhydrolase_6 94 346 2.1e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000082620
Predicted Effect probably benign
Transcript: ENSMUST00000159968
SMART Domains Protein: ENSMUSP00000125261
Gene: ENSMUSG00000033805

DomainStartEndE-ValueType
Pfam:Abhydrolase_5 38 142 7e-12 PFAM
Pfam:Abhydrolase_6 39 142 1.3e-27 PFAM
Pfam:Abhydrolase_1 63 142 5.7e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161246
SMART Domains Protein: ENSMUSP00000123962
Gene: ENSMUSG00000033805

DomainStartEndE-ValueType
Pfam:Abhydrolase_6 1 73 4.8e-17 PFAM
Pfam:Abhydrolase_1 25 73 7.7e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161452
SMART Domains Protein: ENSMUSP00000124661
Gene: ENSMUSG00000033805

DomainStartEndE-ValueType
Pfam:Abhydrolase_5 1 93 2.1e-11 PFAM
Pfam:Abhydrolase_6 1 94 5e-26 PFAM
Pfam:Abhydrolase_1 25 94 5.7e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000171723
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199508
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.7%
Validation Efficiency 95% (57/60)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf5 A C 17: 43,441,969 T396P probably damaging Het
Apob A T 12: 8,016,083 I4318F possibly damaging Het
Apol7c T G 15: 77,526,389 D119A probably benign Het
App G T 16: 85,056,433 D252E unknown Het
C4a T A 17: 34,814,908 noncoding transcript Het
Cacna1b T C 2: 24,702,620 Y515C probably damaging Het
Cacna1f G T X: 7,609,974 A123S probably damaging Het
Cldn6 G C 17: 23,681,520 A153P probably benign Het
Cmya5 T C 13: 93,091,956 N2208S probably benign Het
Csnk1g1 A G 9: 66,019,853 T101A probably benign Het
Ddx46 T A 13: 55,663,236 D544E probably benign Het
Dmxl1 T A 18: 49,878,017 C1080* probably null Het
Dst T C 1: 34,251,878 S3335P probably damaging Het
Efnb3 T C 11: 69,555,945 K313R probably damaging Het
Elf2 G A 3: 51,308,149 Q47* probably null Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Epc2 A G 2: 49,547,554 K657E possibly damaging Het
Ereg T C 5: 91,086,800 I24T probably benign Het
Evc2 C A 5: 37,338,669 A41D possibly damaging Het
Fkbp15 A G 4: 62,336,414 V283A probably benign Het
Flrt3 T C 2: 140,660,407 T434A probably damaging Het
Gm572 A G 4: 148,654,865 D50G possibly damaging Het
Hecw1 C T 13: 14,316,164 D748N probably damaging Het
Hivep3 A C 4: 120,096,089 H534P possibly damaging Het
Hspa4l C A 3: 40,766,809 probably null Het
Ipo7 T C 7: 110,029,712 M63T possibly damaging Het
Ipo7 A T 7: 110,048,216 T614S possibly damaging Het
Krt83 T G 15: 101,487,514 M326L probably benign Het
Mbd5 T A 2: 49,272,966 N261K probably damaging Het
Mcam T A 9: 44,134,697 L3Q probably damaging Het
Mcoln3 C A 3: 146,140,492 T519K possibly damaging Het
Mrgprx1 C A 7: 48,021,193 A269S probably damaging Het
Mypn T C 10: 63,192,708 E192G probably benign Het
Nup205 C A 6: 35,192,027 P397Q probably benign Het
Obsl1 A C 1: 75,488,049 L1576R possibly damaging Het
Ofcc1 A G 13: 40,015,461 S817P probably benign Het
Olfr800 A T 10: 129,660,531 M242L probably benign Het
Olfr876 A T 9: 37,804,190 H93L probably benign Het
Pcdhgb7 A G 18: 37,754,072 Y765C possibly damaging Het
Pde7a A G 3: 19,310,862 probably null Het
Phip C T 9: 82,900,869 probably benign Het
Rhbdl2 T A 4: 123,809,935 M1K probably null Het
Ripor2 C T 13: 24,721,711 P947S probably benign Het
Sf3a3 A G 4: 124,725,139 T298A probably benign Het
Slc25a29 C T 12: 108,831,171 probably benign Het
Spinkl T G 18: 44,174,583 T4P possibly damaging Het
Stk33 G A 7: 109,279,795 S449L probably benign Het
Suz12 T A 11: 80,002,162 probably benign Het
Timp2 T A 11: 118,310,671 I124F probably damaging Het
Tlr1 C T 5: 64,925,837 D466N probably benign Het
Tmem200b A G 4: 131,922,470 I234V possibly damaging Het
Ubr1 C A 2: 120,970,603 probably benign Het
Usp33 C A 3: 152,368,512 Q332K probably benign Het
Zfr A G 15: 12,156,330 E634G probably damaging Het
Other mutations in Ephx4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Ephx4 APN 5 107406125 splice site probably benign
IGL01382:Ephx4 APN 5 107429719 missense probably damaging 1.00
IGL01916:Ephx4 APN 5 107406030 critical splice acceptor site probably null
IGL03301:Ephx4 APN 5 107426864 missense probably benign
G5030:Ephx4 UTSW 5 107429827 missense probably damaging 0.99
R0055:Ephx4 UTSW 5 107413078 missense probably damaging 1.00
R0055:Ephx4 UTSW 5 107413078 missense probably damaging 1.00
R0408:Ephx4 UTSW 5 107413521 missense probably damaging 1.00
R0413:Ephx4 UTSW 5 107403735 missense probably benign 0.00
R0471:Ephx4 UTSW 5 107413513 missense possibly damaging 0.51
R1570:Ephx4 UTSW 5 107419851 missense probably damaging 1.00
R3700:Ephx4 UTSW 5 107402807 missense probably benign 0.00
R5895:Ephx4 UTSW 5 107429652 splice site probably null
R5933:Ephx4 UTSW 5 107403765 unclassified probably null
R6326:Ephx4 UTSW 5 107406111 missense probably damaging 1.00
R6505:Ephx4 UTSW 5 107403656 nonsense probably null
R6606:Ephx4 UTSW 5 107413065 missense probably damaging 1.00
R6848:Ephx4 UTSW 5 107426918 missense probably damaging 1.00
R6901:Ephx4 UTSW 5 107413561 missense probably benign 0.29
R7017:Ephx4 UTSW 5 107406114 missense probably damaging 0.98
R7484:Ephx4 UTSW 5 107429746 missense probably damaging 1.00
R7999:Ephx4 UTSW 5 107419833 missense probably damaging 1.00
X0019:Ephx4 UTSW 5 107419860 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TCTACTGGTCCCTGGTGTAC -3'
(R):5'- CGTTCTGAAACACGCACCTC -3'

Sequencing Primer
(F):5'- TCCCTGGTGTACGGCTACTG -3'
(R):5'- ACACACACACATAGGTTAAGGAG -3'
Posted On2015-07-06