Incidental Mutation 'R4366:Stk33'
ID325752
Institutional Source Beutler Lab
Gene Symbol Stk33
Ensembl Gene ENSMUSG00000031027
Gene Nameserine/threonine kinase 33
Synonyms
MMRRC Submission 041114-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R4366 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location109279223-109439081 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 109279795 bp
ZygosityHeterozygous
Amino Acid Change Serine to Leucine at position 449 (S449L)
Ref Sequence ENSEMBL: ENSMUSP00000112515 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090414] [ENSMUST00000106745] [ENSMUST00000121378] [ENSMUST00000121748] [ENSMUST00000141210]
Predicted Effect probably benign
Transcript: ENSMUST00000090414
AA Change: S449L

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000087897
Gene: ENSMUSG00000031027
AA Change: S449L

DomainStartEndE-ValueType
S_TKc 111 377 4.7e-102 SMART
low complexity region 399 414 N/A INTRINSIC
low complexity region 445 467 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106745
AA Change: S449L

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000102356
Gene: ENSMUSG00000031027
AA Change: S449L

DomainStartEndE-ValueType
S_TKc 111 377 4.7e-102 SMART
low complexity region 399 414 N/A INTRINSIC
low complexity region 445 467 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121378
AA Change: S326L

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000112560
Gene: ENSMUSG00000031027
AA Change: S326L

DomainStartEndE-ValueType
S_TKc 2 254 1.01e-83 SMART
low complexity region 276 291 N/A INTRINSIC
low complexity region 322 344 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121748
AA Change: S449L

PolyPhen 2 Score 0.057 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000112515
Gene: ENSMUSG00000031027
AA Change: S449L

DomainStartEndE-ValueType
S_TKc 111 377 4.8e-102 SMART
low complexity region 399 414 N/A INTRINSIC
low complexity region 445 467 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000141210
AA Change: S57L
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.7%
Validation Efficiency 95% (57/60)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf5 A C 17: 43,441,969 T396P probably damaging Het
Apob A T 12: 8,016,083 I4318F possibly damaging Het
Apol7c T G 15: 77,526,389 D119A probably benign Het
App G T 16: 85,056,433 D252E unknown Het
C4a T A 17: 34,814,908 noncoding transcript Het
Cacna1b T C 2: 24,702,620 Y515C probably damaging Het
Cacna1f G T X: 7,609,974 A123S probably damaging Het
Cldn6 G C 17: 23,681,520 A153P probably benign Het
Cmya5 T C 13: 93,091,956 N2208S probably benign Het
Csnk1g1 A G 9: 66,019,853 T101A probably benign Het
Ddx46 T A 13: 55,663,236 D544E probably benign Het
Dmxl1 T A 18: 49,878,017 C1080* probably null Het
Dst T C 1: 34,251,878 S3335P probably damaging Het
Efnb3 T C 11: 69,555,945 K313R probably damaging Het
Elf2 G A 3: 51,308,149 Q47* probably null Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Epc2 A G 2: 49,547,554 K657E possibly damaging Het
Ephx4 A G 5: 107,403,813 probably benign Het
Ereg T C 5: 91,086,800 I24T probably benign Het
Evc2 C A 5: 37,338,669 A41D possibly damaging Het
Fkbp15 A G 4: 62,336,414 V283A probably benign Het
Flrt3 T C 2: 140,660,407 T434A probably damaging Het
Gm572 A G 4: 148,654,865 D50G possibly damaging Het
Hecw1 C T 13: 14,316,164 D748N probably damaging Het
Hivep3 A C 4: 120,096,089 H534P possibly damaging Het
Hspa4l C A 3: 40,766,809 probably null Het
Ipo7 T C 7: 110,029,712 M63T possibly damaging Het
Ipo7 A T 7: 110,048,216 T614S possibly damaging Het
Krt83 T G 15: 101,487,514 M326L probably benign Het
Mbd5 T A 2: 49,272,966 N261K probably damaging Het
Mcam T A 9: 44,134,697 L3Q probably damaging Het
Mcoln3 C A 3: 146,140,492 T519K possibly damaging Het
Mrgprx1 C A 7: 48,021,193 A269S probably damaging Het
Mypn T C 10: 63,192,708 E192G probably benign Het
Nup205 C A 6: 35,192,027 P397Q probably benign Het
Obsl1 A C 1: 75,488,049 L1576R possibly damaging Het
Ofcc1 A G 13: 40,015,461 S817P probably benign Het
Olfr800 A T 10: 129,660,531 M242L probably benign Het
Olfr876 A T 9: 37,804,190 H93L probably benign Het
Pcdhgb7 A G 18: 37,754,072 Y765C possibly damaging Het
Pde7a A G 3: 19,310,862 probably null Het
Phip C T 9: 82,900,869 probably benign Het
Rhbdl2 T A 4: 123,809,935 M1K probably null Het
Ripor2 C T 13: 24,721,711 P947S probably benign Het
Sf3a3 A G 4: 124,725,139 T298A probably benign Het
Slc25a29 C T 12: 108,831,171 probably benign Het
Spinkl T G 18: 44,174,583 T4P possibly damaging Het
Suz12 T A 11: 80,002,162 probably benign Het
Timp2 T A 11: 118,310,671 I124F probably damaging Het
Tlr1 C T 5: 64,925,837 D466N probably benign Het
Tmem200b A G 4: 131,922,470 I234V possibly damaging Het
Ubr1 C A 2: 120,970,603 probably benign Het
Usp33 C A 3: 152,368,512 Q332K probably benign Het
Zfr A G 15: 12,156,330 E634G probably damaging Het
Other mutations in Stk33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01137:Stk33 APN 7 109329568 missense probably benign 0.02
IGL01467:Stk33 APN 7 109329589 missense probably damaging 0.99
IGL01558:Stk33 APN 7 109341284 intron probably benign
IGL01775:Stk33 APN 7 109312367 missense possibly damaging 0.92
R0052:Stk33 UTSW 7 109279669 missense possibly damaging 0.46
R0336:Stk33 UTSW 7 109331474 missense probably benign 0.01
R0394:Stk33 UTSW 7 109341489 missense probably benign
R0579:Stk33 UTSW 7 109325697 missense probably damaging 0.99
R0727:Stk33 UTSW 7 109321518 missense probably damaging 0.96
R1363:Stk33 UTSW 7 109279821 missense probably benign 0.06
R1574:Stk33 UTSW 7 109279820 missense probably benign 0.01
R1574:Stk33 UTSW 7 109279820 missense probably benign 0.01
R2153:Stk33 UTSW 7 109341320 missense probably benign 0.01
R4896:Stk33 UTSW 7 109327595 missense probably damaging 1.00
R4994:Stk33 UTSW 7 109340398 missense probably benign 0.08
R5283:Stk33 UTSW 7 109336127 missense possibly damaging 0.69
R6339:Stk33 UTSW 7 109321465 missense probably benign 0.03
R6547:Stk33 UTSW 7 109320835 missense possibly damaging 0.73
R6717:Stk33 UTSW 7 109327616 missense possibly damaging 0.51
R6894:Stk33 UTSW 7 109336062 missense possibly damaging 0.70
Z1176:Stk33 UTSW 7 109336059 missense possibly damaging 0.51
Predicted Primers PCR Primer
(F):5'- AAGAGTGGTCTGTTCTTGAACTGC -3'
(R):5'- CTGAACACCTTGGTTCTCAGG -3'

Sequencing Primer
(F):5'- TTGAACTGCTCAGCACTGGAC -3'
(R):5'- CACCTTGGTTCTCAGGAAAGTAG -3'
Posted On2015-07-06