Incidental Mutation 'R4366:Ipo7'
ID325753
Institutional Source Beutler Lab
Gene Symbol Ipo7
Ensembl Gene ENSMUSG00000066232
Gene Nameimportin 7
SynonymsA330055O14Rik, Imp7, RanBP7
MMRRC Submission 041114-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R4366 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location110018274-110056609 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 110029712 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 63 (M63T)
Ref Sequence ENSEMBL: ENSMUSP00000081782 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084731] [ENSMUST00000208951]
Predicted Effect possibly damaging
Transcript: ENSMUST00000084731
AA Change: M63T

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000081782
Gene: ENSMUSG00000066232
AA Change: M63T

DomainStartEndE-ValueType
IBN_N 22 101 3.06e-15 SMART
Pfam:Cse1 168 452 2.8e-12 PFAM
low complexity region 701 712 N/A INTRINSIC
low complexity region 881 900 N/A INTRINSIC
low complexity region 923 939 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185931
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207277
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208408
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208821
Predicted Effect probably benign
Transcript: ENSMUST00000208951
Meta Mutation Damage Score 0.4493 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.7%
Validation Efficiency 95% (57/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The importin-alpha/beta complex and the GTPase Ran mediate nuclear import of proteins with a classical nuclear localization signal. The protein encoded by this gene is a member of a class of approximately 20 potential Ran targets that share a sequence motif related to the Ran-binding site of importin-beta. Similar to importin-beta, this protein prevents the activation of Ran's GTPase by RanGAP1 and inhibits nucleotide exchange on RanGTP, and also binds directly to nuclear pore complexes where it competes for binding sites with importin-beta and transportin. This protein has a Ran-dependent transport cycle and it can cross the nuclear envelope rapidly and in both directions. At least four importin beta-like transport receptors, namely importin beta itself, transportin, RanBP5 and RanBP7, directly bind and import ribosomal proteins. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf5 A C 17: 43,441,969 T396P probably damaging Het
Apob A T 12: 8,016,083 I4318F possibly damaging Het
Apol7c T G 15: 77,526,389 D119A probably benign Het
App G T 16: 85,056,433 D252E unknown Het
C4a T A 17: 34,814,908 noncoding transcript Het
Cacna1b T C 2: 24,702,620 Y515C probably damaging Het
Cacna1f G T X: 7,609,974 A123S probably damaging Het
Cldn6 G C 17: 23,681,520 A153P probably benign Het
Cmya5 T C 13: 93,091,956 N2208S probably benign Het
Csnk1g1 A G 9: 66,019,853 T101A probably benign Het
Ddx46 T A 13: 55,663,236 D544E probably benign Het
Dmxl1 T A 18: 49,878,017 C1080* probably null Het
Dst T C 1: 34,251,878 S3335P probably damaging Het
Efnb3 T C 11: 69,555,945 K313R probably damaging Het
Elf2 G A 3: 51,308,149 Q47* probably null Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Epc2 A G 2: 49,547,554 K657E possibly damaging Het
Ephx4 A G 5: 107,403,813 probably benign Het
Ereg T C 5: 91,086,800 I24T probably benign Het
Evc2 C A 5: 37,338,669 A41D possibly damaging Het
Fkbp15 A G 4: 62,336,414 V283A probably benign Het
Flrt3 T C 2: 140,660,407 T434A probably damaging Het
Gm572 A G 4: 148,654,865 D50G possibly damaging Het
Hecw1 C T 13: 14,316,164 D748N probably damaging Het
Hivep3 A C 4: 120,096,089 H534P possibly damaging Het
Hspa4l C A 3: 40,766,809 probably null Het
Krt83 T G 15: 101,487,514 M326L probably benign Het
Mbd5 T A 2: 49,272,966 N261K probably damaging Het
Mcam T A 9: 44,134,697 L3Q probably damaging Het
Mcoln3 C A 3: 146,140,492 T519K possibly damaging Het
Mrgprx1 C A 7: 48,021,193 A269S probably damaging Het
Mypn T C 10: 63,192,708 E192G probably benign Het
Nup205 C A 6: 35,192,027 P397Q probably benign Het
Obsl1 A C 1: 75,488,049 L1576R possibly damaging Het
Ofcc1 A G 13: 40,015,461 S817P probably benign Het
Olfr800 A T 10: 129,660,531 M242L probably benign Het
Olfr876 A T 9: 37,804,190 H93L probably benign Het
Pcdhgb7 A G 18: 37,754,072 Y765C possibly damaging Het
Pde7a A G 3: 19,310,862 probably null Het
Phip C T 9: 82,900,869 probably benign Het
Rhbdl2 T A 4: 123,809,935 M1K probably null Het
Ripor2 C T 13: 24,721,711 P947S probably benign Het
Sf3a3 A G 4: 124,725,139 T298A probably benign Het
Slc25a29 C T 12: 108,831,171 probably benign Het
Spinkl T G 18: 44,174,583 T4P possibly damaging Het
Stk33 G A 7: 109,279,795 S449L probably benign Het
Suz12 T A 11: 80,002,162 probably benign Het
Timp2 T A 11: 118,310,671 I124F probably damaging Het
Tlr1 C T 5: 64,925,837 D466N probably benign Het
Tmem200b A G 4: 131,922,470 I234V possibly damaging Het
Ubr1 C A 2: 120,970,603 probably benign Het
Usp33 C A 3: 152,368,512 Q332K probably benign Het
Zfr A G 15: 12,156,330 E634G probably damaging Het
Other mutations in Ipo7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01796:Ipo7 APN 7 110029848 intron probably benign
IGL02472:Ipo7 APN 7 110040853 missense probably damaging 1.00
IGL02502:Ipo7 APN 7 110051050 missense probably damaging 1.00
IGL02514:Ipo7 APN 7 110048828 missense possibly damaging 0.78
IGL02535:Ipo7 APN 7 110054026 missense probably damaging 0.98
IGL02961:Ipo7 APN 7 110047016 missense probably benign 0.02
R0089:Ipo7 UTSW 7 110050765 intron probably benign
R0355:Ipo7 UTSW 7 110049661 missense probably benign 0.00
R0565:Ipo7 UTSW 7 110049593 intron probably benign
R1342:Ipo7 UTSW 7 110029804 missense possibly damaging 0.82
R1405:Ipo7 UTSW 7 110029841 missense probably benign 0.03
R1405:Ipo7 UTSW 7 110039249 missense probably damaging 0.97
R1405:Ipo7 UTSW 7 110029841 missense probably benign 0.03
R1405:Ipo7 UTSW 7 110039249 missense probably damaging 0.97
R1791:Ipo7 UTSW 7 110027132 missense probably damaging 0.98
R1838:Ipo7 UTSW 7 110042109 missense probably damaging 1.00
R2116:Ipo7 UTSW 7 110051118 missense probably damaging 0.99
R2120:Ipo7 UTSW 7 110049631 missense probably damaging 1.00
R4366:Ipo7 UTSW 7 110048216 missense possibly damaging 0.88
R4805:Ipo7 UTSW 7 110051484 missense probably benign 0.16
R5228:Ipo7 UTSW 7 110046762 missense probably benign 0.00
R5903:Ipo7 UTSW 7 110050813 missense probably damaging 1.00
R5976:Ipo7 UTSW 7 110048807 missense probably damaging 1.00
R6254:Ipo7 UTSW 7 110049060 missense probably benign 0.00
R6335:Ipo7 UTSW 7 110018468 missense possibly damaging 0.92
R6360:Ipo7 UTSW 7 110027129 missense probably damaging 1.00
R6776:Ipo7 UTSW 7 110047065 missense probably damaging 0.98
R7132:Ipo7 UTSW 7 110054047 missense probably benign 0.17
R7329:Ipo7 UTSW 7 110049017 missense possibly damaging 0.94
R7491:Ipo7 UTSW 7 110039194 missense possibly damaging 0.91
R7763:Ipo7 UTSW 7 110052799 missense possibly damaging 0.62
R8070:Ipo7 UTSW 7 110052807 missense probably benign 0.01
RF017:Ipo7 UTSW 7 110048794 missense probably benign 0.00
X0062:Ipo7 UTSW 7 110052886 missense probably damaging 1.00
X0066:Ipo7 UTSW 7 110052734 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGTGGGTAAATGCCTTCTACTG -3'
(R):5'- ATTAGTCGGCACACTTGGC -3'

Sequencing Primer
(F):5'- CCCCAAAGATACTGTATTCTG -3'
(R):5'- CAGATTTCTGAGTTCAAGGTCAGCC -3'
Posted On2015-07-06