Incidental Mutation 'R4366:Mcam'
ID325756
Institutional Source Beutler Lab
Gene Symbol Mcam
Ensembl Gene ENSMUSG00000032135
Gene Namemelanoma cell adhesion molecule
SynonymsMuc18, CD146, s-gicerin, 1-gicerin, s-endo
MMRRC Submission 041114-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.400) question?
Stock #R4366 (G1)
Quality Score116
Status Not validated
Chromosome9
Chromosomal Location44134469-44142727 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 44134697 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 3 (L3Q)
Ref Sequence ENSEMBL: ENSMUSP00000096451 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034650] [ENSMUST00000098852] [ENSMUST00000147836] [ENSMUST00000149241] [ENSMUST00000216002]
Predicted Effect probably damaging
Transcript: ENSMUST00000034650
AA Change: L3Q

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000034650
Gene: ENSMUSG00000032135
AA Change: L3Q

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IG 35 135 6.61e-4 SMART
IG_like 155 213 4.22e-1 SMART
IG 259 343 8.13e-4 SMART
IGc2 358 416 3.4e-6 SMART
IG_like 445 508 1.92e0 SMART
low complexity region 511 525 N/A INTRINSIC
transmembrane domain 562 584 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000098852
AA Change: L3Q

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000096451
Gene: ENSMUSG00000032135
AA Change: L3Q

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
IG 35 135 6.61e-4 SMART
IG_like 155 213 4.22e-1 SMART
IG 259 343 8.13e-4 SMART
IGc2 358 416 3.4e-6 SMART
IG_like 445 508 1.92e0 SMART
low complexity region 511 525 N/A INTRINSIC
transmembrane domain 562 584 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132490
Predicted Effect probably benign
Transcript: ENSMUST00000147836
SMART Domains Protein: ENSMUSP00000117924
Gene: ENSMUSG00000032135

DomainStartEndE-ValueType
Pfam:V-set 2 97 2.4e-7 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000149241
AA Change: L3Q
SMART Domains Protein: ENSMUSP00000121090
Gene: ENSMUSG00000032135
AA Change: L3Q

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
low complexity region 64 76 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180670
Predicted Effect unknown
Transcript: ENSMUST00000216002
AA Change: L3Q
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.7%
Validation Efficiency 95% (57/60)
MGI Phenotype PHENOTYPE: Mice homozygous for a conditional allele activated in endothelial cells exhibit impaired VEGF-induced angiogenesis in Matrigel. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf5 A C 17: 43,441,969 T396P probably damaging Het
Apob A T 12: 8,016,083 I4318F possibly damaging Het
Apol7c T G 15: 77,526,389 D119A probably benign Het
App G T 16: 85,056,433 D252E unknown Het
C4a T A 17: 34,814,908 noncoding transcript Het
Cacna1b T C 2: 24,702,620 Y515C probably damaging Het
Cacna1f G T X: 7,609,974 A123S probably damaging Het
Cldn6 G C 17: 23,681,520 A153P probably benign Het
Cmya5 T C 13: 93,091,956 N2208S probably benign Het
Csnk1g1 A G 9: 66,019,853 T101A probably benign Het
Ddx46 T A 13: 55,663,236 D544E probably benign Het
Dmxl1 T A 18: 49,878,017 C1080* probably null Het
Dst T C 1: 34,251,878 S3335P probably damaging Het
Efnb3 T C 11: 69,555,945 K313R probably damaging Het
Elf2 G A 3: 51,308,149 Q47* probably null Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Epc2 A G 2: 49,547,554 K657E possibly damaging Het
Ephx4 A G 5: 107,403,813 probably benign Het
Ereg T C 5: 91,086,800 I24T probably benign Het
Evc2 C A 5: 37,338,669 A41D possibly damaging Het
Fkbp15 A G 4: 62,336,414 V283A probably benign Het
Flrt3 T C 2: 140,660,407 T434A probably damaging Het
Gm572 A G 4: 148,654,865 D50G possibly damaging Het
Hecw1 C T 13: 14,316,164 D748N probably damaging Het
Hivep3 A C 4: 120,096,089 H534P possibly damaging Het
Hspa4l C A 3: 40,766,809 probably null Het
Ipo7 T C 7: 110,029,712 M63T possibly damaging Het
Ipo7 A T 7: 110,048,216 T614S possibly damaging Het
Krt83 T G 15: 101,487,514 M326L probably benign Het
Mbd5 T A 2: 49,272,966 N261K probably damaging Het
Mcoln3 C A 3: 146,140,492 T519K possibly damaging Het
Mrgprx1 C A 7: 48,021,193 A269S probably damaging Het
Mypn T C 10: 63,192,708 E192G probably benign Het
Nup205 C A 6: 35,192,027 P397Q probably benign Het
Obsl1 A C 1: 75,488,049 L1576R possibly damaging Het
Ofcc1 A G 13: 40,015,461 S817P probably benign Het
Olfr800 A T 10: 129,660,531 M242L probably benign Het
Olfr876 A T 9: 37,804,190 H93L probably benign Het
Pcdhgb7 A G 18: 37,754,072 Y765C possibly damaging Het
Pde7a A G 3: 19,310,862 probably null Het
Phip C T 9: 82,900,869 probably benign Het
Rhbdl2 T A 4: 123,809,935 M1K probably null Het
Ripor2 C T 13: 24,721,711 P947S probably benign Het
Sf3a3 A G 4: 124,725,139 T298A probably benign Het
Slc25a29 C T 12: 108,831,171 probably benign Het
Spinkl T G 18: 44,174,583 T4P possibly damaging Het
Stk33 G A 7: 109,279,795 S449L probably benign Het
Suz12 T A 11: 80,002,162 probably benign Het
Timp2 T A 11: 118,310,671 I124F probably damaging Het
Tlr1 C T 5: 64,925,837 D466N probably benign Het
Tmem200b A G 4: 131,922,470 I234V possibly damaging Het
Ubr1 C A 2: 120,970,603 probably benign Het
Usp33 C A 3: 152,368,512 Q332K probably benign Het
Zfr A G 15: 12,156,330 E634G probably damaging Het
Other mutations in Mcam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02408:Mcam APN 9 44140250 missense probably benign 0.01
IGL02671:Mcam APN 9 44137034 splice site probably benign
IGL02682:Mcam APN 9 44140417 missense possibly damaging 0.80
IGL03384:Mcam APN 9 44140512 unclassified probably benign
R0238:Mcam UTSW 9 44140205 unclassified probably null
R0238:Mcam UTSW 9 44140205 unclassified probably null
R0320:Mcam UTSW 9 44140186 missense possibly damaging 0.89
R1432:Mcam UTSW 9 44141291 missense probably damaging 0.98
R1485:Mcam UTSW 9 44136763 missense probably damaging 1.00
R1503:Mcam UTSW 9 44141291 missense probably damaging 0.98
R1730:Mcam UTSW 9 44134706 missense probably damaging 1.00
R1783:Mcam UTSW 9 44134706 missense probably damaging 1.00
R2146:Mcam UTSW 9 44136635 missense probably damaging 0.99
R2150:Mcam UTSW 9 44136635 missense probably damaging 0.99
R2215:Mcam UTSW 9 44139953 nonsense probably null
R4519:Mcam UTSW 9 44141343 missense possibly damaging 0.95
R4948:Mcam UTSW 9 44136566 missense probably damaging 1.00
R5965:Mcam UTSW 9 44136628 missense probably damaging 1.00
R6704:Mcam UTSW 9 44136920 missense probably benign 0.06
R6955:Mcam UTSW 9 44139269 missense probably damaging 1.00
R7273:Mcam UTSW 9 44140944 missense possibly damaging 0.78
R7529:Mcam UTSW 9 44138895 missense probably benign 0.08
R7623:Mcam UTSW 9 44139658 missense probably benign 0.28
R7659:Mcam UTSW 9 44136770 missense unknown
R8066:Mcam UTSW 9 44140960 missense probably damaging 1.00
Z1177:Mcam UTSW 9 44134590 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CTTTCCAAGCCAGAAAACGG -3'
(R):5'- TGATCTCCGGTACACTCAGG -3'

Sequencing Primer
(F):5'- ACGGGAGTTAGCCTCTAGG -3'
(R):5'- TACACTCAGGCGGCACAGTC -3'
Posted On2015-07-06