Incidental Mutation 'R4366:Olfr800'
ID325760
Institutional Source Beutler Lab
Gene Symbol Olfr800
Ensembl Gene ENSMUSG00000108114
Gene Nameolfactory receptor 800
SynonymsGA_x6K02T2PULF-11338429-11339364, MOR114-7
MMRRC Submission 041114-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.132) question?
Stock #R4366 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location129657694-129662074 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 129660531 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 242 (M242L)
Ref Sequence ENSEMBL: ENSMUSP00000151047 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000104903] [ENSMUST00000217094]
Predicted Effect probably benign
Transcript: ENSMUST00000104903
AA Change: M242L

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000100499
Gene: ENSMUSG00000108114
AA Change: M242L

DomainStartEndE-ValueType
Pfam:7tm_4 28 307 7.3e-43 PFAM
Pfam:7tm_1 38 287 6.9e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217094
AA Change: M242L

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.7%
Validation Efficiency 95% (57/60)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf5 A C 17: 43,441,969 T396P probably damaging Het
Apob A T 12: 8,016,083 I4318F possibly damaging Het
Apol7c T G 15: 77,526,389 D119A probably benign Het
App G T 16: 85,056,433 D252E unknown Het
C4a T A 17: 34,814,908 noncoding transcript Het
Cacna1b T C 2: 24,702,620 Y515C probably damaging Het
Cacna1f G T X: 7,609,974 A123S probably damaging Het
Cldn6 G C 17: 23,681,520 A153P probably benign Het
Cmya5 T C 13: 93,091,956 N2208S probably benign Het
Csnk1g1 A G 9: 66,019,853 T101A probably benign Het
Ddx46 T A 13: 55,663,236 D544E probably benign Het
Dmxl1 T A 18: 49,878,017 C1080* probably null Het
Dst T C 1: 34,251,878 S3335P probably damaging Het
Efnb3 T C 11: 69,555,945 K313R probably damaging Het
Elf2 G A 3: 51,308,149 Q47* probably null Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Epc2 A G 2: 49,547,554 K657E possibly damaging Het
Ephx4 A G 5: 107,403,813 probably benign Het
Ereg T C 5: 91,086,800 I24T probably benign Het
Evc2 C A 5: 37,338,669 A41D possibly damaging Het
Fkbp15 A G 4: 62,336,414 V283A probably benign Het
Flrt3 T C 2: 140,660,407 T434A probably damaging Het
Gm572 A G 4: 148,654,865 D50G possibly damaging Het
Hecw1 C T 13: 14,316,164 D748N probably damaging Het
Hivep3 A C 4: 120,096,089 H534P possibly damaging Het
Hspa4l C A 3: 40,766,809 probably null Het
Ipo7 T C 7: 110,029,712 M63T possibly damaging Het
Ipo7 A T 7: 110,048,216 T614S possibly damaging Het
Krt83 T G 15: 101,487,514 M326L probably benign Het
Mbd5 T A 2: 49,272,966 N261K probably damaging Het
Mcam T A 9: 44,134,697 L3Q probably damaging Het
Mcoln3 C A 3: 146,140,492 T519K possibly damaging Het
Mrgprx1 C A 7: 48,021,193 A269S probably damaging Het
Mypn T C 10: 63,192,708 E192G probably benign Het
Nup205 C A 6: 35,192,027 P397Q probably benign Het
Obsl1 A C 1: 75,488,049 L1576R possibly damaging Het
Ofcc1 A G 13: 40,015,461 S817P probably benign Het
Olfr876 A T 9: 37,804,190 H93L probably benign Het
Pcdhgb7 A G 18: 37,754,072 Y765C possibly damaging Het
Pde7a A G 3: 19,310,862 probably null Het
Phip C T 9: 82,900,869 probably benign Het
Rhbdl2 T A 4: 123,809,935 M1K probably null Het
Ripor2 C T 13: 24,721,711 P947S probably benign Het
Sf3a3 A G 4: 124,725,139 T298A probably benign Het
Slc25a29 C T 12: 108,831,171 probably benign Het
Spinkl T G 18: 44,174,583 T4P possibly damaging Het
Stk33 G A 7: 109,279,795 S449L probably benign Het
Suz12 T A 11: 80,002,162 probably benign Het
Timp2 T A 11: 118,310,671 I124F probably damaging Het
Tlr1 C T 5: 64,925,837 D466N probably benign Het
Tmem200b A G 4: 131,922,470 I234V possibly damaging Het
Ubr1 C A 2: 120,970,603 probably benign Het
Usp33 C A 3: 152,368,512 Q332K probably benign Het
Zfr A G 15: 12,156,330 E634G probably damaging Het
Other mutations in Olfr800
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01322:Olfr800 APN 10 129660126 missense probably benign 0.26
IGL01915:Olfr800 APN 10 129660650 missense probably benign 0.05
IGL02458:Olfr800 APN 10 129660606 missense probably benign 0.38
IGL02721:Olfr800 APN 10 129659955 missense probably benign
R0032:Olfr800 UTSW 10 129660400 missense probably benign 0.05
R0442:Olfr800 UTSW 10 129659824 missense probably benign 0.00
R1564:Olfr800 UTSW 10 129660015 missense probably benign 0.22
R1580:Olfr800 UTSW 10 129660315 missense probably benign 0.10
R1593:Olfr800 UTSW 10 129660225 nonsense probably null
R1911:Olfr800 UTSW 10 129660112 missense probably benign 0.07
R2001:Olfr800 UTSW 10 129660421 missense probably benign 0.02
R2223:Olfr800 UTSW 10 129659809 start codon destroyed probably null 1.00
R3876:Olfr800 UTSW 10 129660274 missense probably benign 0.39
R3884:Olfr800 UTSW 10 129660538 missense probably damaging 1.00
R4689:Olfr800 UTSW 10 129660316 missense probably benign 0.01
R4909:Olfr800 UTSW 10 129660720 missense probably benign 0.01
R5638:Olfr800 UTSW 10 129660100 missense possibly damaging 0.80
R5835:Olfr800 UTSW 10 129659934 missense probably benign 0.39
R5838:Olfr800 UTSW 10 129660038 missense probably benign 0.41
R6150:Olfr800 UTSW 10 129659934 missense probably benign 0.39
R6248:Olfr800 UTSW 10 129660663 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- CTCAAGCTGGAATTCTGTGACTC -3'
(R):5'- TTGAAGGCCTGCTTGACTTG -3'

Sequencing Primer
(F):5'- GACCATTTTGTCTGTGATGCAAACC -3'
(R):5'- GCTTGACTTGTTTGTTCCTCAATG -3'
Posted On2015-07-06