Incidental Mutation 'R4366:Timp2'
ID325763
Institutional Source Beutler Lab
Gene Symbol Timp2
Ensembl Gene ENSMUSG00000017466
Gene Nametissue inhibitor of metalloproteinase 2
SynonymsTimp-2, D11Bwg1104e, TIMP-2
MMRRC Submission 041114-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4366 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location118301069-118355740 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 118310671 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 124 (I124F)
Ref Sequence ENSEMBL: ENSMUSP00000017610 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017610] [ENSMUST00000155707]
Predicted Effect probably damaging
Transcript: ENSMUST00000017610
AA Change: I124F

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000017610
Gene: ENSMUSG00000017466
AA Change: I124F

DomainStartEndE-ValueType
low complexity region 3 26 N/A INTRINSIC
NTR 27 203 1.05e-135 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000155707
AA Change: I47F

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000122642
Gene: ENSMUSG00000017466
AA Change: I47F

DomainStartEndE-ValueType
NTR 1 126 1.48e-71 SMART
Meta Mutation Damage Score 0.1445 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.7%
Validation Efficiency 95% (57/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the TIMP gene family. The proteins encoded by this gene family are natural inhibitors of the matrix metalloproteinases, a group of peptidases involved in degradation of the extracellular matrix. In addition to an inhibitory role against metalloproteinases, the encoded protein has a unique role among TIMP family members in its ability to directly suppress the proliferation of endothelial cells. As a result, the encoded protein may be critical to the maintenance of tissue homeostasis by suppressing the proliferation of quiescent tissues in response to angiogenic factors, and by inhibiting protease activity in tissues undergoing remodelling of the extracellular matrix. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impaired activation of pro-matrix metalloproteinase-2, but appear phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf5 A C 17: 43,441,969 T396P probably damaging Het
Apob A T 12: 8,016,083 I4318F possibly damaging Het
Apol7c T G 15: 77,526,389 D119A probably benign Het
App G T 16: 85,056,433 D252E unknown Het
C4a T A 17: 34,814,908 noncoding transcript Het
Cacna1b T C 2: 24,702,620 Y515C probably damaging Het
Cacna1f G T X: 7,609,974 A123S probably damaging Het
Cldn6 G C 17: 23,681,520 A153P probably benign Het
Cmya5 T C 13: 93,091,956 N2208S probably benign Het
Csnk1g1 A G 9: 66,019,853 T101A probably benign Het
Ddx46 T A 13: 55,663,236 D544E probably benign Het
Dmxl1 T A 18: 49,878,017 C1080* probably null Het
Dst T C 1: 34,251,878 S3335P probably damaging Het
Efnb3 T C 11: 69,555,945 K313R probably damaging Het
Elf2 G A 3: 51,308,149 Q47* probably null Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Epc2 A G 2: 49,547,554 K657E possibly damaging Het
Ephx4 A G 5: 107,403,813 probably benign Het
Ereg T C 5: 91,086,800 I24T probably benign Het
Evc2 C A 5: 37,338,669 A41D possibly damaging Het
Fkbp15 A G 4: 62,336,414 V283A probably benign Het
Flrt3 T C 2: 140,660,407 T434A probably damaging Het
Gm572 A G 4: 148,654,865 D50G possibly damaging Het
Hecw1 C T 13: 14,316,164 D748N probably damaging Het
Hivep3 A C 4: 120,096,089 H534P possibly damaging Het
Hspa4l C A 3: 40,766,809 probably null Het
Ipo7 T C 7: 110,029,712 M63T possibly damaging Het
Ipo7 A T 7: 110,048,216 T614S possibly damaging Het
Krt83 T G 15: 101,487,514 M326L probably benign Het
Mbd5 T A 2: 49,272,966 N261K probably damaging Het
Mcam T A 9: 44,134,697 L3Q probably damaging Het
Mcoln3 C A 3: 146,140,492 T519K possibly damaging Het
Mrgprx1 C A 7: 48,021,193 A269S probably damaging Het
Mypn T C 10: 63,192,708 E192G probably benign Het
Nup205 C A 6: 35,192,027 P397Q probably benign Het
Obsl1 A C 1: 75,488,049 L1576R possibly damaging Het
Ofcc1 A G 13: 40,015,461 S817P probably benign Het
Olfr800 A T 10: 129,660,531 M242L probably benign Het
Olfr876 A T 9: 37,804,190 H93L probably benign Het
Pcdhgb7 A G 18: 37,754,072 Y765C possibly damaging Het
Pde7a A G 3: 19,310,862 probably null Het
Phip C T 9: 82,900,869 probably benign Het
Rhbdl2 T A 4: 123,809,935 M1K probably null Het
Ripor2 C T 13: 24,721,711 P947S probably benign Het
Sf3a3 A G 4: 124,725,139 T298A probably benign Het
Slc25a29 C T 12: 108,831,171 probably benign Het
Spinkl T G 18: 44,174,583 T4P possibly damaging Het
Stk33 G A 7: 109,279,795 S449L probably benign Het
Suz12 T A 11: 80,002,162 probably benign Het
Tlr1 C T 5: 64,925,837 D466N probably benign Het
Tmem200b A G 4: 131,922,470 I234V possibly damaging Het
Ubr1 C A 2: 120,970,603 probably benign Het
Usp33 C A 3: 152,368,512 Q332K probably benign Het
Zfr A G 15: 12,156,330 E634G probably damaging Het
Other mutations in Timp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2508:Timp2 UTSW 11 118310586 missense probably damaging 1.00
R3899:Timp2 UTSW 11 118303716 missense probably damaging 0.99
R3900:Timp2 UTSW 11 118303716 missense probably damaging 0.99
R4632:Timp2 UTSW 11 118303772 missense probably benign 0.00
R5496:Timp2 UTSW 11 118303881 missense probably benign 0.00
R5609:Timp2 UTSW 11 118320161 missense probably damaging 1.00
R5646:Timp2 UTSW 11 118317532 splice site probably null
R7733:Timp2 UTSW 11 118317529 critical splice acceptor site probably null
R7737:Timp2 UTSW 11 118303895 missense probably damaging 1.00
R7808:Timp2 UTSW 11 118303800 missense probably damaging 1.00
Z1177:Timp2 UTSW 11 118310589 missense not run
Predicted Primers PCR Primer
(F):5'- TTGTGATGGACAAGGCCAG -3'
(R):5'- CTGAGAATATGCTGAGTGAGACGC -3'

Sequencing Primer
(F):5'- CAGGGAGGGGTGAGGACTC -3'
(R):5'- TACAGGCATGGTAATCTGCC -3'
Posted On2015-07-06