Incidental Mutation 'R4366:Slc25a29'
ID325766
Institutional Source Beutler Lab
Gene Symbol Slc25a29
Ensembl Gene ENSMUSG00000021265
Gene Namesolute carrier family 25 (mitochondrial carrier, palmitoylcarnitine transporter), member 29
SynonymsCACL, mCACL, C030003J19Rik
MMRRC Submission 041114-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4366 (G1)
Quality Score213
Status Validated
Chromosome12
Chromosomal Location108825873-108835883 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) C to T at 108831171 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000021693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021693]
Predicted Effect probably benign
Transcript: ENSMUST00000021693
SMART Domains Protein: ENSMUSP00000021693
Gene: ENSMUSG00000021265

DomainStartEndE-ValueType
Pfam:Mito_carr 1 91 1.5e-21 PFAM
Pfam:Mito_carr 88 182 4.6e-25 PFAM
Pfam:Mito_carr 185 279 1.8e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137023
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139714
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221453
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223296
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.7%
Validation Efficiency 95% (57/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nuclear-encoded mitochondrial protein that is a member of the large family of solute carrier family 25 (SLC25) mitochondrial transporters. The members of this superfamily are involved in numerous metabolic pathways and cell functions. This gene product was previously reported to be a mitochondrial carnitine-acylcarnitine-like (CACL) translocase (PMID:128829710) or an ornithine transporter (designated ORNT3, PMID:19287344), however, a recent study characterized the main role of this protein as a mitochondrial transporter of basic amino acids, with a preference for arginine and lysine (PMID:24652292). Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Apr 2014]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf5 A C 17: 43,441,969 T396P probably damaging Het
Apob A T 12: 8,016,083 I4318F possibly damaging Het
Apol7c T G 15: 77,526,389 D119A probably benign Het
App G T 16: 85,056,433 D252E unknown Het
C4a T A 17: 34,814,908 noncoding transcript Het
Cacna1b T C 2: 24,702,620 Y515C probably damaging Het
Cacna1f G T X: 7,609,974 A123S probably damaging Het
Cldn6 G C 17: 23,681,520 A153P probably benign Het
Cmya5 T C 13: 93,091,956 N2208S probably benign Het
Csnk1g1 A G 9: 66,019,853 T101A probably benign Het
Ddx46 T A 13: 55,663,236 D544E probably benign Het
Dmxl1 T A 18: 49,878,017 C1080* probably null Het
Dst T C 1: 34,251,878 S3335P probably damaging Het
Efnb3 T C 11: 69,555,945 K313R probably damaging Het
Elf2 G A 3: 51,308,149 Q47* probably null Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Epc2 A G 2: 49,547,554 K657E possibly damaging Het
Ephx4 A G 5: 107,403,813 probably benign Het
Ereg T C 5: 91,086,800 I24T probably benign Het
Evc2 C A 5: 37,338,669 A41D possibly damaging Het
Fkbp15 A G 4: 62,336,414 V283A probably benign Het
Flrt3 T C 2: 140,660,407 T434A probably damaging Het
Gm572 A G 4: 148,654,865 D50G possibly damaging Het
Hecw1 C T 13: 14,316,164 D748N probably damaging Het
Hivep3 A C 4: 120,096,089 H534P possibly damaging Het
Hspa4l C A 3: 40,766,809 probably null Het
Ipo7 T C 7: 110,029,712 M63T possibly damaging Het
Ipo7 A T 7: 110,048,216 T614S possibly damaging Het
Krt83 T G 15: 101,487,514 M326L probably benign Het
Mbd5 T A 2: 49,272,966 N261K probably damaging Het
Mcam T A 9: 44,134,697 L3Q probably damaging Het
Mcoln3 C A 3: 146,140,492 T519K possibly damaging Het
Mrgprx1 C A 7: 48,021,193 A269S probably damaging Het
Mypn T C 10: 63,192,708 E192G probably benign Het
Nup205 C A 6: 35,192,027 P397Q probably benign Het
Obsl1 A C 1: 75,488,049 L1576R possibly damaging Het
Ofcc1 A G 13: 40,015,461 S817P probably benign Het
Olfr800 A T 10: 129,660,531 M242L probably benign Het
Olfr876 A T 9: 37,804,190 H93L probably benign Het
Pcdhgb7 A G 18: 37,754,072 Y765C possibly damaging Het
Pde7a A G 3: 19,310,862 probably null Het
Phip C T 9: 82,900,869 probably benign Het
Rhbdl2 T A 4: 123,809,935 M1K probably null Het
Ripor2 C T 13: 24,721,711 P947S probably benign Het
Sf3a3 A G 4: 124,725,139 T298A probably benign Het
Spinkl T G 18: 44,174,583 T4P possibly damaging Het
Stk33 G A 7: 109,279,795 S449L probably benign Het
Suz12 T A 11: 80,002,162 probably benign Het
Timp2 T A 11: 118,310,671 I124F probably damaging Het
Tlr1 C T 5: 64,925,837 D466N probably benign Het
Tmem200b A G 4: 131,922,470 I234V possibly damaging Het
Ubr1 C A 2: 120,970,603 probably benign Het
Usp33 C A 3: 152,368,512 Q332K probably benign Het
Zfr A G 15: 12,156,330 E634G probably damaging Het
Other mutations in Slc25a29
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03287:Slc25a29 APN 12 108831209 missense possibly damaging 0.49
R0116:Slc25a29 UTSW 12 108827091 missense possibly damaging 0.94
R1876:Slc25a29 UTSW 12 108827711 missense probably damaging 0.98
R2094:Slc25a29 UTSW 12 108827432 missense probably damaging 1.00
R2233:Slc25a29 UTSW 12 108835661 missense possibly damaging 0.92
R2276:Slc25a29 UTSW 12 108826926 missense probably benign 0.09
R2277:Slc25a29 UTSW 12 108826926 missense probably benign 0.09
R2279:Slc25a29 UTSW 12 108826926 missense probably benign 0.09
R2383:Slc25a29 UTSW 12 108827008 missense probably damaging 1.00
R7859:Slc25a29 UTSW 12 108826830 missense probably benign 0.01
R7942:Slc25a29 UTSW 12 108826830 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTGACACAAACGCTTGGCTG -3'
(R):5'- GTTACCAGAGGGGACATTACAG -3'

Sequencing Primer
(F):5'- ACAAACGCTTGGCTGTGGAC -3'
(R):5'- CATTACAGGAATCCCTAGGATGGGC -3'
Posted On2015-07-06