Incidental Mutation 'R4366:Hecw1'
ID325767
Institutional Source Beutler Lab
Gene Symbol Hecw1
Ensembl Gene ENSMUSG00000021301
Gene NameHECT, C2 and WW domain containing E3 ubiquitin protein ligase 1
SynonymsE130207I19Rik, NEDL1
MMRRC Submission 041114-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4366 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location14226438-14523228 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 14316164 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 748 (D748N)
Ref Sequence ENSEMBL: ENSMUSP00000106145 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110516] [ENSMUST00000220718]
Predicted Effect probably damaging
Transcript: ENSMUST00000110516
AA Change: D748N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106145
Gene: ENSMUSG00000021301
AA Change: D748N

DomainStartEndE-ValueType
Pfam:HECW_N 65 184 6.5e-62 PFAM
C2 206 317 1.02e-12 SMART
low complexity region 463 477 N/A INTRINSIC
low complexity region 497 512 N/A INTRINSIC
low complexity region 577 598 N/A INTRINSIC
low complexity region 677 704 N/A INTRINSIC
low complexity region 731 745 N/A INTRINSIC
WW 827 859 8.66e-13 SMART
coiled coil region 873 898 N/A INTRINSIC
low complexity region 917 930 N/A INTRINSIC
WW 1017 1049 5.59e-7 SMART
Blast:HECTc 1137 1192 3e-26 BLAST
low complexity region 1193 1208 N/A INTRINSIC
low complexity region 1212 1223 N/A INTRINSIC
HECTc 1267 1604 1.36e-185 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000220718
AA Change: D335N

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221863
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222241
Meta Mutation Damage Score 0.0888 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.7%
Validation Efficiency 95% (57/60)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf5 A C 17: 43,441,969 T396P probably damaging Het
Apob A T 12: 8,016,083 I4318F possibly damaging Het
Apol7c T G 15: 77,526,389 D119A probably benign Het
App G T 16: 85,056,433 D252E unknown Het
C4a T A 17: 34,814,908 noncoding transcript Het
Cacna1b T C 2: 24,702,620 Y515C probably damaging Het
Cacna1f G T X: 7,609,974 A123S probably damaging Het
Cldn6 G C 17: 23,681,520 A153P probably benign Het
Cmya5 T C 13: 93,091,956 N2208S probably benign Het
Csnk1g1 A G 9: 66,019,853 T101A probably benign Het
Ddx46 T A 13: 55,663,236 D544E probably benign Het
Dmxl1 T A 18: 49,878,017 C1080* probably null Het
Dst T C 1: 34,251,878 S3335P probably damaging Het
Efnb3 T C 11: 69,555,945 K313R probably damaging Het
Elf2 G A 3: 51,308,149 Q47* probably null Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Epc2 A G 2: 49,547,554 K657E possibly damaging Het
Ephx4 A G 5: 107,403,813 probably benign Het
Ereg T C 5: 91,086,800 I24T probably benign Het
Evc2 C A 5: 37,338,669 A41D possibly damaging Het
Fkbp15 A G 4: 62,336,414 V283A probably benign Het
Flrt3 T C 2: 140,660,407 T434A probably damaging Het
Gm572 A G 4: 148,654,865 D50G possibly damaging Het
Hivep3 A C 4: 120,096,089 H534P possibly damaging Het
Hspa4l C A 3: 40,766,809 probably null Het
Ipo7 T C 7: 110,029,712 M63T possibly damaging Het
Ipo7 A T 7: 110,048,216 T614S possibly damaging Het
Krt83 T G 15: 101,487,514 M326L probably benign Het
Mbd5 T A 2: 49,272,966 N261K probably damaging Het
Mcam T A 9: 44,134,697 L3Q probably damaging Het
Mcoln3 C A 3: 146,140,492 T519K possibly damaging Het
Mrgprx1 C A 7: 48,021,193 A269S probably damaging Het
Mypn T C 10: 63,192,708 E192G probably benign Het
Nup205 C A 6: 35,192,027 P397Q probably benign Het
Obsl1 A C 1: 75,488,049 L1576R possibly damaging Het
Ofcc1 A G 13: 40,015,461 S817P probably benign Het
Olfr800 A T 10: 129,660,531 M242L probably benign Het
Olfr876 A T 9: 37,804,190 H93L probably benign Het
Pcdhgb7 A G 18: 37,754,072 Y765C possibly damaging Het
Pde7a A G 3: 19,310,862 probably null Het
Phip C T 9: 82,900,869 probably benign Het
Rhbdl2 T A 4: 123,809,935 M1K probably null Het
Ripor2 C T 13: 24,721,711 P947S probably benign Het
Sf3a3 A G 4: 124,725,139 T298A probably benign Het
Slc25a29 C T 12: 108,831,171 probably benign Het
Spinkl T G 18: 44,174,583 T4P possibly damaging Het
Stk33 G A 7: 109,279,795 S449L probably benign Het
Suz12 T A 11: 80,002,162 probably benign Het
Timp2 T A 11: 118,310,671 I124F probably damaging Het
Tlr1 C T 5: 64,925,837 D466N probably benign Het
Tmem200b A G 4: 131,922,470 I234V possibly damaging Het
Ubr1 C A 2: 120,970,603 probably benign Het
Usp33 C A 3: 152,368,512 Q332K probably benign Het
Zfr A G 15: 12,156,330 E634G probably damaging Het
Other mutations in Hecw1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00591:Hecw1 APN 13 14265980 missense possibly damaging 0.71
IGL00813:Hecw1 APN 13 14278376 critical splice acceptor site probably null
IGL00843:Hecw1 APN 13 14247573 missense probably benign 0.02
IGL00942:Hecw1 APN 13 14340740 splice site probably benign
IGL00976:Hecw1 APN 13 14318972 missense probably damaging 1.00
IGL01289:Hecw1 APN 13 14264134 missense probably damaging 1.00
IGL01675:Hecw1 APN 13 14234422 missense probably damaging 1.00
IGL01783:Hecw1 APN 13 14278293 missense probably damaging 1.00
IGL01941:Hecw1 APN 13 14316310 missense probably benign 0.01
IGL02170:Hecw1 APN 13 14264158 missense possibly damaging 0.75
IGL02172:Hecw1 APN 13 14264149 missense probably damaging 1.00
IGL02214:Hecw1 APN 13 14300393 missense probably damaging 1.00
IGL02350:Hecw1 APN 13 14248338 splice site probably null
IGL02357:Hecw1 APN 13 14248338 splice site probably null
IGL02372:Hecw1 APN 13 14264121 missense probably damaging 1.00
IGL02591:Hecw1 APN 13 14357236 splice site probably benign
IGL02718:Hecw1 APN 13 14306935 critical splice acceptor site probably null
IGL02795:Hecw1 APN 13 14322517 missense probably damaging 1.00
IGL02941:Hecw1 APN 13 14377726 missense probably damaging 1.00
IGL03256:Hecw1 APN 13 14280484 missense probably damaging 0.99
IGL03256:Hecw1 APN 13 14280485 missense probably benign 0.36
IGL03366:Hecw1 APN 13 14377797 missense probably damaging 1.00
deflated UTSW 13 14247620 missense possibly damaging 0.69
Demoralized UTSW 13 14316818 nonsense probably null
Letdown UTSW 13 14316492 missense probably benign 0.40
IGL03014:Hecw1 UTSW 13 14245808 missense probably damaging 1.00
PIT4378001:Hecw1 UTSW 13 14377783 missense probably damaging 0.98
R0555:Hecw1 UTSW 13 14236941 missense probably damaging 1.00
R0617:Hecw1 UTSW 13 14280442 missense probably benign 0.44
R1476:Hecw1 UTSW 13 14306086 missense probably damaging 1.00
R1479:Hecw1 UTSW 13 14316492 missense probably benign 0.40
R1551:Hecw1 UTSW 13 14316943 missense probably damaging 1.00
R1579:Hecw1 UTSW 13 14377907 missense probably damaging 1.00
R1584:Hecw1 UTSW 13 14340743 critical splice donor site probably null
R1735:Hecw1 UTSW 13 14377765 missense probably null 0.09
R1872:Hecw1 UTSW 13 14280449 nonsense probably null
R1897:Hecw1 UTSW 13 14377940 missense probably damaging 1.00
R2054:Hecw1 UTSW 13 14297413 missense probably damaging 0.97
R2085:Hecw1 UTSW 13 14264087 missense possibly damaging 0.93
R2134:Hecw1 UTSW 13 14377700 missense probably damaging 1.00
R2172:Hecw1 UTSW 13 14377706 missense probably damaging 1.00
R2258:Hecw1 UTSW 13 14316138 missense probably benign 0.01
R2274:Hecw1 UTSW 13 14346068 missense probably benign 0.00
R2275:Hecw1 UTSW 13 14346068 missense probably benign 0.00
R2937:Hecw1 UTSW 13 14245836 missense possibly damaging 0.93
R3830:Hecw1 UTSW 13 14346058 missense probably benign 0.13
R3971:Hecw1 UTSW 13 14236929 missense probably damaging 1.00
R4065:Hecw1 UTSW 13 14316431 missense probably damaging 1.00
R4066:Hecw1 UTSW 13 14316431 missense probably damaging 1.00
R4235:Hecw1 UTSW 13 14317139 missense probably benign 0.42
R4382:Hecw1 UTSW 13 14316164 missense probably damaging 1.00
R4385:Hecw1 UTSW 13 14316164 missense probably damaging 1.00
R4510:Hecw1 UTSW 13 14357191 missense probably damaging 1.00
R4511:Hecw1 UTSW 13 14357191 missense probably damaging 1.00
R4558:Hecw1 UTSW 13 14247605 missense probably damaging 0.99
R4804:Hecw1 UTSW 13 14305985 missense probably benign 0.00
R4854:Hecw1 UTSW 13 14316892 missense probably benign 0.00
R5104:Hecw1 UTSW 13 14340792 missense probably damaging 1.00
R5113:Hecw1 UTSW 13 14346029 missense possibly damaging 0.94
R5167:Hecw1 UTSW 13 14285657 missense probably damaging 1.00
R5392:Hecw1 UTSW 13 14245762 missense probably damaging 1.00
R5394:Hecw1 UTSW 13 14322589 missense probably damaging 1.00
R5504:Hecw1 UTSW 13 14340902 missense probably benign 0.04
R5764:Hecw1 UTSW 13 14322509 missense probably damaging 1.00
R6038:Hecw1 UTSW 13 14346062 missense probably benign 0.28
R6038:Hecw1 UTSW 13 14346062 missense probably benign 0.28
R6228:Hecw1 UTSW 13 14346038 missense probably damaging 1.00
R6247:Hecw1 UTSW 13 14234425 nonsense probably null
R6252:Hecw1 UTSW 13 14272079 missense probably damaging 0.98
R6291:Hecw1 UTSW 13 14523007 unclassified probably benign
R6321:Hecw1 UTSW 13 14522829 missense probably benign 0.00
R6325:Hecw1 UTSW 13 14316446 missense probably damaging 1.00
R6328:Hecw1 UTSW 13 14247620 missense possibly damaging 0.69
R6557:Hecw1 UTSW 13 14316646 missense possibly damaging 0.78
R6566:Hecw1 UTSW 13 14297283 missense probably damaging 1.00
R6597:Hecw1 UTSW 13 14316818 nonsense probably null
R6821:Hecw1 UTSW 13 14264134 missense probably damaging 1.00
R6914:Hecw1 UTSW 13 14316838 missense probably damaging 0.99
R7078:Hecw1 UTSW 13 14434459 start codon destroyed probably null 0.21
R7114:Hecw1 UTSW 13 14311771 missense probably benign 0.02
R7140:Hecw1 UTSW 13 14316533 missense probably benign
R7150:Hecw1 UTSW 13 14434460 start codon destroyed probably benign
R7288:Hecw1 UTSW 13 14316236 missense probably benign 0.00
R7447:Hecw1 UTSW 13 14357204 missense probably damaging 1.00
R7479:Hecw1 UTSW 13 14340840 missense probably damaging 1.00
R7552:Hecw1 UTSW 13 14316250 missense probably damaging 0.99
R7590:Hecw1 UTSW 13 14264083 missense probably damaging 1.00
R7787:Hecw1 UTSW 13 14318909 missense probably damaging 1.00
R7803:Hecw1 UTSW 13 14234342 missense probably benign 0.25
RF001:Hecw1 UTSW 13 14297424 missense probably damaging 1.00
X0020:Hecw1 UTSW 13 14230723 missense possibly damaging 0.52
X0066:Hecw1 UTSW 13 14280460 missense probably benign 0.13
Z1176:Hecw1 UTSW 13 14300333 missense possibly damaging 0.77
Predicted Primers PCR Primer
(F):5'- GACTGGTCTCTCCACCAATC -3'
(R):5'- AGCAGCTCTTGTTACAGCAGC -3'

Sequencing Primer
(F):5'- CAATCATTTGGGGAAACTTGTGTCC -3'
(R):5'- TTACAGCAGCTCCTGTTACAGCAG -3'
Posted On2015-07-06