Incidental Mutation 'R0012:Myh8'
ID32577
Institutional Source Beutler Lab
Gene Symbol Myh8
Ensembl Gene ENSMUSG00000055775
Gene Namemyosin, heavy polypeptide 8, skeletal muscle, perinatal
SynonymsMyhsp, 4832426G23Rik, MyHC-pn, Myhs-p
MMRRC Submission 038307-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.783) question?
Stock #R0012 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location67277124-67308634 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 67300021 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 1350 (Y1350H)
Ref Sequence ENSEMBL: ENSMUSP00000019625 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019625]
Predicted Effect probably benign
Transcript: ENSMUST00000019625
AA Change: Y1350H

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000019625
Gene: ENSMUSG00000055775
AA Change: Y1350H

DomainStartEndE-ValueType
Pfam:Myosin_N 37 76 2.1e-13 PFAM
MYSc 82 782 N/A SMART
IQ 783 805 5.44e-3 SMART
Pfam:Myosin_tail_1 846 1927 2.4e-164 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000108686
Meta Mutation Damage Score 0.0907 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.7%
Validation Efficiency 98% (81/83)
MGI Phenotype FUNCTION: This gene encodes a myosin heavy chain. The encoded protein forms a hexamer with two heavy chains, two alkali light chains, and two regulatory light chain components. This complex functions in muscle contraction. This gene is located in a cluster of related genes on chromosome 11. [provided by RefSeq, Jun 2013]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam33 A T 2: 131,052,920 L687Q probably damaging Het
Adap1 A G 5: 139,307,734 probably benign Het
Add2 T A 6: 86,098,628 V253E probably damaging Het
Agtr1a A T 13: 30,381,749 I266F probably damaging Het
Anxa9 A G 3: 95,308,095 probably benign Het
Arap2 G A 5: 62,683,484 L680F probably damaging Het
Asna1 T C 8: 85,025,096 probably benign Het
Bnip3 A G 7: 138,898,672 probably benign Het
Brwd1 A C 16: 96,059,652 S311R probably damaging Het
C2cd3 G A 7: 100,418,522 V871M possibly damaging Het
Cacul1 A G 19: 60,564,253 W145R probably damaging Het
Celf5 C A 10: 81,469,512 V141L probably damaging Het
Cfap206 C A 4: 34,714,519 L392F possibly damaging Het
Chd2 G T 7: 73,455,519 T192K probably damaging Het
Chrna10 T C 7: 102,115,057 N40S possibly damaging Het
Cic T A 7: 25,287,140 S1299T probably damaging Het
Cic C A 7: 25,287,141 S1299Y probably damaging Het
Clspn T A 4: 126,564,929 probably benign Het
Clstn1 G A 4: 149,634,796 V361M probably damaging Het
Col5a3 A T 9: 20,777,108 probably benign Het
Copb1 T A 7: 114,237,408 K366N probably damaging Het
Cul9 G A 17: 46,538,510 R570C probably benign Het
Cyp2c70 A T 19: 40,187,243 L7Q probably null Het
Dock2 T C 11: 34,783,795 E10G possibly damaging Het
Dpysl4 T G 7: 139,097,883 I412S probably benign Het
Eaf2 T A 16: 36,808,174 probably benign Het
Fasl T C 1: 161,788,164 D41G probably benign Het
Fat2 A G 11: 55,262,871 V3505A probably benign Het
Fbxo24 A G 5: 137,621,994 F101S probably damaging Het
Fdft1 T C 14: 63,177,698 I28M probably benign Het
Gcnt3 T C 9: 70,034,085 I400M probably benign Het
Gpd2 T A 2: 57,338,868 M228K probably damaging Het
Gsap T A 5: 21,226,229 probably benign Het
Hipk1 A G 3: 103,763,680 M467T probably damaging Het
Hmgb4 T A 4: 128,260,725 I17F probably damaging Het
Ints10 C A 8: 68,807,475 L284M probably benign Het
Kif17 T G 4: 138,293,748 S606A probably damaging Het
Lifr C A 15: 7,175,608 T442K possibly damaging Het
Lypd4 A G 7: 24,865,332 L127P probably damaging Het
Lyst A G 13: 13,687,694 H2605R probably benign Het
Map3k4 A G 17: 12,238,189 S1289P probably damaging Het
Mgam T A 6: 40,765,256 probably null Het
Mob1b G A 5: 88,756,084 probably benign Het
Mrgpra1 A G 7: 47,335,470 S154P probably damaging Het
Ms4a4c C A 19: 11,418,980 probably benign Het
Mthfd2l A T 5: 90,961,383 H224L probably damaging Het
Nectin2 T C 7: 19,730,744 probably benign Het
Nos1 A C 5: 117,893,902 N305T probably damaging Het
Ogfrl1 T A 1: 23,370,125 Q340L possibly damaging Het
Olfr1318 A T 2: 112,156,826 N292Y possibly damaging Het
Olfr1502 C A 19: 13,861,823 T10K probably damaging Het
Olfr170 T C 16: 19,606,440 N76S probably benign Het
Olfr427 T G 1: 174,100,207 F250V probably damaging Het
Orc1 T C 4: 108,595,646 probably null Het
Plekhg5 C A 4: 152,104,750 D249E probably benign Het
Plet1 A G 9: 50,499,130 I74V probably benign Het
Psmd2 T A 16: 20,661,684 D718E probably damaging Het
Rab33b G T 3: 51,484,316 probably benign Het
Rae1 T A 2: 173,002,673 F4I unknown Het
Ralgapa2 A G 2: 146,412,752 Y821H probably benign Het
Scd2 G A 19: 44,301,246 V227I probably benign Het
Sharpin G T 15: 76,348,343 P156T possibly damaging Het
Slc38a4 C T 15: 96,999,629 R435H probably damaging Het
Snrnp200 T C 2: 127,228,549 V1061A probably benign Het
Suclg1 A G 6: 73,270,997 T234A possibly damaging Het
Swsap1 T C 9: 21,957,022 C197R probably benign Het
Tbx15 A G 3: 99,352,096 T428A probably benign Het
Tet2 T C 3: 133,476,558 Y1215C probably damaging Het
Tjp1 A G 7: 65,329,775 probably benign Het
Tmem209 G T 6: 30,502,113 probably benign Het
Tnpo3 T C 6: 29,589,177 E58G probably damaging Het
Trp53bp2 T A 1: 182,444,718 M464K probably damaging Het
Ttc32 A G 12: 9,035,897 Y148C possibly damaging Het
Unc80 T C 1: 66,507,391 S541P probably damaging Het
Ushbp1 T C 8: 71,395,040 probably benign Het
Vmn2r100 A G 17: 19,504,874 M22V probably benign Het
Vmn2r100 A T 17: 19,526,034 E485V probably damaging Het
Wdr24 G A 17: 25,827,113 V471I probably benign Het
Zfp35 T A 18: 24,002,944 M115K probably benign Het
Zfp429 G A 13: 67,390,677 S216L probably benign Het
Zfp644 T G 5: 106,635,043 E1155A probably benign Het
Other mutations in Myh8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Myh8 APN 11 67283818 missense probably damaging 0.97
IGL01020:Myh8 APN 11 67283403 missense probably damaging 0.99
IGL01348:Myh8 APN 11 67297780 missense probably damaging 1.00
IGL01382:Myh8 APN 11 67301973 missense probably damaging 1.00
IGL01454:Myh8 APN 11 67283596 missense probably damaging 1.00
IGL01457:Myh8 APN 11 67292679 missense probably benign 0.00
IGL01472:Myh8 APN 11 67288379 splice site probably benign
IGL01473:Myh8 APN 11 67301825 critical splice donor site probably null
IGL01613:Myh8 APN 11 67301710 missense probably benign 0.11
IGL01763:Myh8 APN 11 67286419 missense probably benign 0.01
IGL01828:Myh8 APN 11 67303826 missense possibly damaging 0.82
IGL01862:Myh8 APN 11 67289694 nonsense probably null
IGL01905:Myh8 APN 11 67284651 missense possibly damaging 0.90
IGL02280:Myh8 APN 11 67283372 unclassified probably benign
IGL02386:Myh8 APN 11 67294440 missense probably damaging 0.99
IGL02449:Myh8 APN 11 67294614 critical splice donor site probably null
IGL02500:Myh8 APN 11 67305710 missense probably benign 0.00
IGL02745:Myh8 APN 11 67297501 missense possibly damaging 0.88
IGL02799:Myh8 APN 11 67301592 splice site probably benign
IGL03063:Myh8 APN 11 67288205 missense probably benign 0.00
IGL03223:Myh8 APN 11 67283818 missense probably damaging 0.97
IGL03336:Myh8 APN 11 67284702 missense probably damaging 1.00
IGL03338:Myh8 APN 11 67298346 missense probably damaging 1.00
IGL03351:Myh8 APN 11 67303913 missense possibly damaging 0.94
IGL03392:Myh8 APN 11 67294418 missense probably damaging 1.00
PIT4354001:Myh8 UTSW 11 67289630 missense probably benign 0.01
R0016:Myh8 UTSW 11 67298525 missense probably damaging 1.00
R0016:Myh8 UTSW 11 67298525 missense probably damaging 1.00
R0115:Myh8 UTSW 11 67306264 splice site probably benign
R0131:Myh8 UTSW 11 67292188 missense probably damaging 0.96
R0131:Myh8 UTSW 11 67292188 missense probably damaging 0.96
R0132:Myh8 UTSW 11 67292188 missense probably damaging 0.96
R0238:Myh8 UTSW 11 67301692 missense probably benign 0.00
R0238:Myh8 UTSW 11 67301692 missense probably benign 0.00
R0239:Myh8 UTSW 11 67301692 missense probably benign 0.00
R0239:Myh8 UTSW 11 67301692 missense probably benign 0.00
R0393:Myh8 UTSW 11 67306017 splice site probably benign
R0453:Myh8 UTSW 11 67292905 missense probably benign 0.03
R0454:Myh8 UTSW 11 67303765 nonsense probably null
R0466:Myh8 UTSW 11 67298579 missense probably benign 0.01
R0487:Myh8 UTSW 11 67302011 missense probably benign
R0511:Myh8 UTSW 11 67284507 missense probably benign 0.01
R0557:Myh8 UTSW 11 67301798 missense possibly damaging 0.88
R0589:Myh8 UTSW 11 67298627 missense probably benign 0.00
R0658:Myh8 UTSW 11 67284532 critical splice donor site probably null
R0782:Myh8 UTSW 11 67289754 missense probably benign 0.16
R0829:Myh8 UTSW 11 67283500 unclassified probably benign
R0845:Myh8 UTSW 11 67286264 missense probably damaging 1.00
R0930:Myh8 UTSW 11 67305998 missense possibly damaging 0.93
R0972:Myh8 UTSW 11 67297759 missense probably damaging 1.00
R1132:Myh8 UTSW 11 67297131 nonsense probably null
R1417:Myh8 UTSW 11 67306185 missense probably damaging 1.00
R1478:Myh8 UTSW 11 67292725 missense probably benign 0.23
R1497:Myh8 UTSW 11 67289812 missense probably benign 0.00
R1605:Myh8 UTSW 11 67301671 missense probably damaging 0.99
R1701:Myh8 UTSW 11 67280138 missense probably damaging 1.00
R1950:Myh8 UTSW 11 67279004 missense possibly damaging 0.75
R1989:Myh8 UTSW 11 67292724 missense probably benign 0.00
R2010:Myh8 UTSW 11 67297164 nonsense probably null
R2095:Myh8 UTSW 11 67286224 missense probably benign 0.00
R2132:Myh8 UTSW 11 67292876 missense probably damaging 1.00
R2152:Myh8 UTSW 11 67294469 missense probably damaging 0.97
R2229:Myh8 UTSW 11 67308348 missense probably damaging 0.98
R2302:Myh8 UTSW 11 67286239 missense probably damaging 1.00
R2364:Myh8 UTSW 11 67294518 missense probably benign 0.03
R2429:Myh8 UTSW 11 67303897 missense probably benign 0.21
R2880:Myh8 UTSW 11 67297264 missense probably damaging 0.97
R3692:Myh8 UTSW 11 67301918 missense probably damaging 0.98
R3756:Myh8 UTSW 11 67284617 unclassified probably benign
R3924:Myh8 UTSW 11 67297137 missense probably damaging 0.99
R4172:Myh8 UTSW 11 67292421 missense probably damaging 1.00
R4255:Myh8 UTSW 11 67299734 missense probably benign
R4621:Myh8 UTSW 11 67286258 missense probably damaging 1.00
R4623:Myh8 UTSW 11 67286258 missense probably damaging 1.00
R4790:Myh8 UTSW 11 67279963 missense probably damaging 0.99
R4914:Myh8 UTSW 11 67292684 missense probably damaging 1.00
R5074:Myh8 UTSW 11 67305916 missense possibly damaging 0.79
R5119:Myh8 UTSW 11 67298358 missense probably damaging 1.00
R5159:Myh8 UTSW 11 67288353 missense probably damaging 0.99
R5229:Myh8 UTSW 11 67284484 missense probably damaging 0.96
R5320:Myh8 UTSW 11 67286263 missense probably damaging 1.00
R5455:Myh8 UTSW 11 67301418 missense possibly damaging 0.59
R5523:Myh8 UTSW 11 67305962 missense possibly damaging 0.95
R5540:Myh8 UTSW 11 67286440 missense probably benign 0.00
R5726:Myh8 UTSW 11 67294566 missense possibly damaging 0.79
R5770:Myh8 UTSW 11 67297200 missense probably damaging 1.00
R6135:Myh8 UTSW 11 67297500 missense possibly damaging 0.51
R6253:Myh8 UTSW 11 67301967 missense probably benign 0.06
R6318:Myh8 UTSW 11 67299341 missense probably benign 0.00
R6432:Myh8 UTSW 11 67298579 missense probably benign 0.01
R6452:Myh8 UTSW 11 67292449 missense probably benign 0.27
R6452:Myh8 UTSW 11 67305739 missense possibly damaging 0.88
R6512:Myh8 UTSW 11 67289662 nonsense probably null
R6714:Myh8 UTSW 11 67306949 missense probably damaging 1.00
R6842:Myh8 UTSW 11 67284655 missense probably damaging 1.00
R7007:Myh8 UTSW 11 67288316 missense probably benign 0.03
R7025:Myh8 UTSW 11 67297539 missense probably benign 0.02
R7086:Myh8 UTSW 11 67292627 splice site probably null
R7098:Myh8 UTSW 11 67279053 missense probably benign 0.03
R7498:Myh8 UTSW 11 67283437 missense possibly damaging 0.80
R7716:Myh8 UTSW 11 67298652 missense possibly damaging 0.51
R7765:Myh8 UTSW 11 67303655 missense probably benign 0.44
R7825:Myh8 UTSW 11 67303712 missense possibly damaging 0.94
R8003:Myh8 UTSW 11 67299760 missense probably damaging 1.00
T0722:Myh8 UTSW 11 67304436 missense probably benign 0.41
Z1088:Myh8 UTSW 11 67298592 missense probably damaging 1.00
Z1176:Myh8 UTSW 11 67303674 missense probably damaging 1.00
Z1177:Myh8 UTSW 11 67301424 missense probably damaging 0.99
Z1177:Myh8 UTSW 11 67308355 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- TGTCAAGGAGCAAGCAGGCATC -3'
(R):5'- GGGCAAAACTCGTCTTCTCTTCAGC -3'

Sequencing Primer
(F):5'- ACCAAGGTGAGTTTTACCCG -3'
(R):5'- CTTGCTGCATTAGGGAGCAC -3'
Posted On2013-05-09