Incidental Mutation 'R4366:Cacna1f'
ID325782
Institutional Source Beutler Lab
Gene Symbol Cacna1f
Ensembl Gene ENSMUSG00000031142
Gene Namecalcium channel, voltage-dependent, alpha 1F subunit
SynonymsCav1.4, Sfc17
MMRRC Submission 041114-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4366 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location7607083-7635196 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 7609974 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Serine at position 123 (A123S)
Ref Sequence ENSEMBL: ENSMUSP00000111391 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033483] [ENSMUST00000115725] [ENSMUST00000115726] [ENSMUST00000133637] [ENSMUST00000155090]
Predicted Effect probably benign
Transcript: ENSMUST00000033483
SMART Domains Protein: ENSMUSP00000033483
Gene: ENSMUSG00000031143

DomainStartEndE-ValueType
Pfam:DUF812 1 597 8.4e-216 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115725
AA Change: A123S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000111390
Gene: ENSMUSG00000031142
AA Change: A123S

DomainStartEndE-ValueType
Pfam:Ion_trans 129 371 9.3e-59 PFAM
PDB:4DEY|B 372 415 2e-21 PDB
low complexity region 455 469 N/A INTRINSIC
low complexity region 479 491 N/A INTRINSIC
transmembrane domain 525 547 N/A INTRINSIC
Pfam:Ion_trans 563 757 3.8e-44 PFAM
coiled coil region 806 834 N/A INTRINSIC
Pfam:Ion_trans 909 1139 1.1e-50 PFAM
Pfam:Ion_trans 1227 1436 2.7e-64 PFAM
Pfam:PKD_channel 1272 1443 1e-10 PFAM
Blast:EFh 1457 1485 2e-8 BLAST
Ca_chan_IQ 1571 1605 3.71e-14 SMART
low complexity region 1636 1655 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000115726
AA Change: A123S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000111391
Gene: ENSMUSG00000031142
AA Change: A123S

DomainStartEndE-ValueType
Pfam:Ion_trans 91 383 2.1e-70 PFAM
low complexity region 455 469 N/A INTRINSIC
low complexity region 479 491 N/A INTRINSIC
low complexity region 509 525 N/A INTRINSIC
Pfam:Ion_trans 528 768 3.8e-54 PFAM
coiled coil region 806 834 N/A INTRINSIC
Pfam:Ion_trans 873 1151 2.4e-59 PFAM
Pfam:Ion_trans 1192 1455 2.6e-67 PFAM
Pfam:PKD_channel 1285 1450 8.5e-10 PFAM
Pfam:GPHH 1457 1526 2.7e-37 PFAM
Ca_chan_IQ 1578 1612 3.71e-14 SMART
Pfam:CAC1F_C 1622 1983 1.5e-164 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126170
Predicted Effect possibly damaging
Transcript: ENSMUST00000133637
AA Change: A123S

PolyPhen 2 Score 0.831 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000116051
Gene: ENSMUSG00000031142
AA Change: A123S

DomainStartEndE-ValueType
transmembrane domain 96 115 N/A INTRINSIC
Pfam:Ion_trans 129 371 4.8e-59 PFAM
PDB:4DEY|B 372 415 9e-22 PDB
low complexity region 455 469 N/A INTRINSIC
low complexity region 479 491 N/A INTRINSIC
transmembrane domain 525 547 N/A INTRINSIC
Pfam:Ion_trans 563 757 2.2e-44 PFAM
low complexity region 822 832 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141634
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144522
Predicted Effect probably benign
Transcript: ENSMUST00000155090
AA Change: A123S

PolyPhen 2 Score 0.164 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000138116
Gene: ENSMUSG00000031142
AA Change: A123S

DomainStartEndE-ValueType
transmembrane domain 96 115 N/A INTRINSIC
Pfam:Ion_trans 129 371 1.1e-59 PFAM
PDB:4DEY|B 372 415 4e-22 PDB
Meta Mutation Damage Score 0.1233 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.7%
Validation Efficiency 95% (57/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multipass transmembrane protein that functions as an alpha-1 subunit of the voltage-dependent calcium channel, which mediates the influx of calcium ions into the cell. The encoded protein forms a complex of alpha-1, alpha-2/delta, beta, and gamma subunits in a 1:1:1:1 ratio. Mutations in this gene can cause X-linked eye disorders, including congenital stationary night blindness type 2A, cone-rod dystropy, and Aland Island eye disease. Alternatively spliced transcript variants encoding multiple isoforms have been observed. [provided by RefSeq, Aug 2013]
PHENOTYPE: Homozygous or hemizygous mutation of this gene results in impaired eye electrophysiology, abnormal retinal neuronal layer, bipolar cell, and horizontal cell morphology, and impaired retinal synapse morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf5 A C 17: 43,441,969 T396P probably damaging Het
Apob A T 12: 8,016,083 I4318F possibly damaging Het
Apol7c T G 15: 77,526,389 D119A probably benign Het
App G T 16: 85,056,433 D252E unknown Het
C4a T A 17: 34,814,908 noncoding transcript Het
Cacna1b T C 2: 24,702,620 Y515C probably damaging Het
Cldn6 G C 17: 23,681,520 A153P probably benign Het
Cmya5 T C 13: 93,091,956 N2208S probably benign Het
Csnk1g1 A G 9: 66,019,853 T101A probably benign Het
Ddx46 T A 13: 55,663,236 D544E probably benign Het
Dmxl1 T A 18: 49,878,017 C1080* probably null Het
Dst T C 1: 34,251,878 S3335P probably damaging Het
Efnb3 T C 11: 69,555,945 K313R probably damaging Het
Elf2 G A 3: 51,308,149 Q47* probably null Het
Elmsan1 C T 12: 84,156,471 G886S probably benign Het
Epc2 A G 2: 49,547,554 K657E possibly damaging Het
Ephx4 A G 5: 107,403,813 probably benign Het
Ereg T C 5: 91,086,800 I24T probably benign Het
Evc2 C A 5: 37,338,669 A41D possibly damaging Het
Fkbp15 A G 4: 62,336,414 V283A probably benign Het
Flrt3 T C 2: 140,660,407 T434A probably damaging Het
Gm572 A G 4: 148,654,865 D50G possibly damaging Het
Hecw1 C T 13: 14,316,164 D748N probably damaging Het
Hivep3 A C 4: 120,096,089 H534P possibly damaging Het
Hspa4l C A 3: 40,766,809 probably null Het
Ipo7 T C 7: 110,029,712 M63T possibly damaging Het
Ipo7 A T 7: 110,048,216 T614S possibly damaging Het
Krt83 T G 15: 101,487,514 M326L probably benign Het
Mbd5 T A 2: 49,272,966 N261K probably damaging Het
Mcam T A 9: 44,134,697 L3Q probably damaging Het
Mcoln3 C A 3: 146,140,492 T519K possibly damaging Het
Mrgprx1 C A 7: 48,021,193 A269S probably damaging Het
Mypn T C 10: 63,192,708 E192G probably benign Het
Nup205 C A 6: 35,192,027 P397Q probably benign Het
Obsl1 A C 1: 75,488,049 L1576R possibly damaging Het
Ofcc1 A G 13: 40,015,461 S817P probably benign Het
Olfr800 A T 10: 129,660,531 M242L probably benign Het
Olfr876 A T 9: 37,804,190 H93L probably benign Het
Pcdhgb7 A G 18: 37,754,072 Y765C possibly damaging Het
Pde7a A G 3: 19,310,862 probably null Het
Phip C T 9: 82,900,869 probably benign Het
Rhbdl2 T A 4: 123,809,935 M1K probably null Het
Ripor2 C T 13: 24,721,711 P947S probably benign Het
Sf3a3 A G 4: 124,725,139 T298A probably benign Het
Slc25a29 C T 12: 108,831,171 probably benign Het
Spinkl T G 18: 44,174,583 T4P possibly damaging Het
Stk33 G A 7: 109,279,795 S449L probably benign Het
Suz12 T A 11: 80,002,162 probably benign Het
Timp2 T A 11: 118,310,671 I124F probably damaging Het
Tlr1 C T 5: 64,925,837 D466N probably benign Het
Tmem200b A G 4: 131,922,470 I234V possibly damaging Het
Ubr1 C A 2: 120,970,603 probably benign Het
Usp33 C A 3: 152,368,512 Q332K probably benign Het
Zfr A G 15: 12,156,330 E634G probably damaging Het
Other mutations in Cacna1f
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00796:Cacna1f APN X 7631031 missense probably damaging 1.00
IGL01693:Cacna1f APN X 7625367 missense probably damaging 1.00
IGL02143:Cacna1f APN X 7613995 intron probably benign
IGL02167:Cacna1f APN X 7616019 missense probably damaging 1.00
IGL02381:Cacna1f APN X 7616068 missense probably damaging 1.00
IGL02466:Cacna1f APN X 7629405 splice site probably null
IGL03006:Cacna1f APN X 7626903 missense probably damaging 1.00
FR4304:Cacna1f UTSW X 7620061 utr 3 prime probably benign
FR4340:Cacna1f UTSW X 7620067 utr 3 prime probably benign
FR4548:Cacna1f UTSW X 7620058 utr 3 prime probably benign
R0629:Cacna1f UTSW X 7620434 missense probably damaging 0.99
R1791:Cacna1f UTSW X 7620439 missense probably damaging 0.99
R2507:Cacna1f UTSW X 7626448 unclassified probably null
R2508:Cacna1f UTSW X 7626448 unclassified probably null
R4195:Cacna1f UTSW X 7608930 missense probably damaging 1.00
R4365:Cacna1f UTSW X 7609974 missense probably damaging 1.00
RF011:Cacna1f UTSW X 7620056 utr 3 prime probably benign
RF025:Cacna1f UTSW X 7620057 nonsense probably null
RF026:Cacna1f UTSW X 7620075 nonsense probably null
RF027:Cacna1f UTSW X 7620054 nonsense probably null
RF028:Cacna1f UTSW X 7620060 utr 3 prime probably benign
RF028:Cacna1f UTSW X 7620063 utr 3 prime probably benign
RF032:Cacna1f UTSW X 7620063 nonsense probably null
RF035:Cacna1f UTSW X 7620054 nonsense probably null
RF040:Cacna1f UTSW X 7618971 frame shift probably null
RF044:Cacna1f UTSW X 7620057 nonsense probably null
RF056:Cacna1f UTSW X 7620075 nonsense probably null
RF060:Cacna1f UTSW X 7620060 utr 3 prime probably benign
Z1088:Cacna1f UTSW X 7610251 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAATGTCCAAACCTTGAAGTC -3'
(R):5'- GAAGGCCTCGATTTATTTCGG -3'

Sequencing Primer
(F):5'- TCCAAACCTTGAAGTCTAGAATTAAC -3'
(R):5'- ATTTCGGGGCAGGGTCAGAC -3'
Posted On2015-07-06