Incidental Mutation 'R4367:Gpr162'
ID325803
Institutional Source Beutler Lab
Gene Symbol Gpr162
Ensembl Gene ENSMUSG00000038390
Gene NameG protein-coupled receptor 162
SynonymsA-2, Grca
MMRRC Submission 041673-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #R4367 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location124858444-124863983 bp(-) (GRCm38)
Type of Mutationstart gained
DNA Base Change (assembly) G to A at 124861695 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000145267 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023958] [ENSMUST00000024044] [ENSMUST00000046893] [ENSMUST00000135127] [ENSMUST00000204667]
Predicted Effect probably benign
Transcript: ENSMUST00000023958
SMART Domains Protein: ENSMUSP00000023958
Gene: ENSMUSG00000023191

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 58 76 N/A INTRINSIC
low complexity region 127 142 N/A INTRINSIC
low complexity region 222 242 N/A INTRINSIC
low complexity region 256 277 N/A INTRINSIC
P4Hc 460 670 8.51e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000024044
SMART Domains Protein: ENSMUSP00000024044
Gene: ENSMUSG00000023274

DomainStartEndE-ValueType
low complexity region 6 21 N/A INTRINSIC
IGv 37 114 7.02e-8 SMART
IG 131 206 3.63e-1 SMART
IG 212 317 3.36e0 SMART
transmembrane domain 394 416 N/A INTRINSIC
Pfam:Tcell_CD4_C 425 452 2.2e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000046893
SMART Domains Protein: ENSMUSP00000038536
Gene: ENSMUSG00000038390

DomainStartEndE-ValueType
Pfam:7tm_1 30 337 1.1e-19 PFAM
low complexity region 348 362 N/A INTRINSIC
low complexity region 462 477 N/A INTRINSIC
low complexity region 482 504 N/A INTRINSIC
low complexity region 513 540 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000135127
SMART Domains Protein: ENSMUSP00000116338
Gene: ENSMUSG00000023191

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 58 76 N/A INTRINSIC
low complexity region 127 142 N/A INTRINSIC
low complexity region 222 242 N/A INTRINSIC
low complexity region 256 277 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145977
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204161
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204253
Predicted Effect probably benign
Transcript: ENSMUST00000204667
SMART Domains Protein: ENSMUSP00000145267
Gene: ENSMUSG00000038390

DomainStartEndE-ValueType
Pfam:7tm_1 30 337 1.1e-19 PFAM
low complexity region 348 362 N/A INTRINSIC
low complexity region 462 477 N/A INTRINSIC
low complexity region 482 504 N/A INTRINSIC
low complexity region 513 540 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified upon genomic analysis of a gene-dense region at human chromosome 12p13. It appears to be mainly expressed in the brain; however, its function is not known. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adrb2 T C 18: 62,179,056 I233V probably damaging Het
Alox5 T A 6: 116,460,963 Y21F possibly damaging Het
Ank2 T C 3: 126,946,149 T1942A probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Bckdk C T 7: 127,906,419 A238V probably benign Het
Casp1 A G 9: 5,299,333 T21A probably benign Het
Ccdc39 T C 3: 33,826,522 H432R probably benign Het
Cttnbp2 A C 6: 18,405,249 C574G probably damaging Het
Cyp1a1 T C 9: 57,700,149 V20A probably benign Het
Dhx38 C T 8: 109,553,131 V976I probably damaging Het
Dnah6 A G 6: 73,149,484 S1287P possibly damaging Het
Dnttip2 T C 3: 122,276,497 S454P probably damaging Het
Doxl2 T C 6: 48,976,130 S330P probably damaging Het
Drp2 A T X: 134,435,135 probably benign Het
Flcn C T 11: 59,803,784 V121I possibly damaging Het
Fmo1 G C 1: 162,833,648 Y355* probably null Het
Git2 T A 5: 114,764,666 H138L probably damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kcnt1 T C 2: 25,907,626 I881T probably damaging Het
Lama3 T A 18: 12,513,690 C1754S probably damaging Het
Mpp3 A T 11: 102,023,420 D116E probably benign Het
Myh11 T C 16: 14,218,883 D985G probably damaging Het
Necap1 T C 6: 122,887,378 V273A probably damaging Het
Nlrc5 T C 8: 94,476,564 S431P probably damaging Het
Nutm2 A T 13: 50,469,884 T206S probably benign Het
Olfr27 G A 9: 39,144,429 A110T probably damaging Het
Olfr507 C T 7: 108,621,889 L26F probably benign Het
Olfr707 GAACAACAACAA GAACAACAA 7: 106,891,360 probably benign Het
Phactr2 A G 10: 13,253,820 S235P probably damaging Het
Podnl1 G A 8: 84,127,268 R89H probably benign Het
Prpf38b T C 3: 108,911,171 Y91C probably damaging Het
Radil C T 5: 142,494,805 A632T probably benign Het
Rpap2 G A 5: 107,601,795 V62I possibly damaging Het
Sdf2 C T 11: 78,251,037 T66I probably damaging Het
Specc1 T C 11: 62,118,530 S371P probably damaging Het
Suco T C 1: 161,847,230 E416G probably damaging Het
Sys1 T C 2: 164,461,395 W10R probably damaging Het
Tarsl2 C T 7: 65,682,819 T556M probably damaging Het
Tcirg1 C T 19: 3,899,069 D407N probably damaging Het
Tefm G T 11: 80,140,330 L27I probably benign Het
Tenm2 A G 11: 36,027,398 I1845T probably benign Het
Tfam A T 10: 71,233,403 I119N probably damaging Het
Tle1 ACAGGTTTCTTCAGGTTTCTT ACAGGTTTCTT 4: 72,118,163 probably benign Het
Trpm6 T C 19: 18,827,525 I947T probably damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Usp54 T C 14: 20,561,134 T1205A probably benign Het
Vmn2r25 T C 6: 123,828,537 R454G probably damaging Het
Xylb T C 9: 119,388,715 V477A probably benign Het
Other mutations in Gpr162
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01134:Gpr162 APN 6 124858857 unclassified probably null
IGL01879:Gpr162 APN 6 124861241 missense probably damaging 1.00
IGL01901:Gpr162 APN 6 124861407 missense possibly damaging 0.95
IGL01930:Gpr162 APN 6 124861612 missense possibly damaging 0.82
IGL02334:Gpr162 APN 6 124861160 missense probably damaging 1.00
R1036:Gpr162 UTSW 6 124860860 missense probably damaging 0.99
R1322:Gpr162 UTSW 6 124858901 missense probably damaging 0.96
R1351:Gpr162 UTSW 6 124861198 missense probably damaging 1.00
R1549:Gpr162 UTSW 6 124860088 missense probably damaging 1.00
R1933:Gpr162 UTSW 6 124861447 missense probably damaging 0.98
R4214:Gpr162 UTSW 6 124860068 missense probably damaging 1.00
R4628:Gpr162 UTSW 6 124861442 missense probably benign 0.03
R5290:Gpr162 UTSW 6 124861269 missense probably benign 0.17
R5354:Gpr162 UTSW 6 124859637 missense probably benign 0.06
R5404:Gpr162 UTSW 6 124861643 missense possibly damaging 0.73
R5465:Gpr162 UTSW 6 124861171 missense probably damaging 1.00
R5520:Gpr162 UTSW 6 124860913 missense probably damaging 1.00
R5566:Gpr162 UTSW 6 124860938 nonsense probably null
R6184:Gpr162 UTSW 6 124861241 missense probably damaging 1.00
R6450:Gpr162 UTSW 6 124861189 missense possibly damaging 0.84
R6685:Gpr162 UTSW 6 124861531 missense probably damaging 1.00
R6807:Gpr162 UTSW 6 124861201 missense probably damaging 0.97
R6972:Gpr162 UTSW 6 124861309 missense probably damaging 0.99
R6982:Gpr162 UTSW 6 124860956 missense probably damaging 1.00
R7543:Gpr162 UTSW 6 124861392 nonsense probably null
Predicted Primers
Posted On2015-07-06