Incidental Mutation 'R4367:Olfr707'
ID 325806
Institutional Source Beutler Lab
Gene Symbol Olfr707
Ensembl Gene ENSMUSG00000069390
Gene Name olfactory receptor 707
Synonyms MOR260-8P, GA_x6K02T2PBJ9-9276470-9275547
MMRRC Submission 041673-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.114) question?
Stock # R4367 (G1)
Quality Score 217
Status Validated
Chromosome 7
Chromosomal Location 106890446-106901241 bp(-) (GRCm38)
Type of Mutation small deletion (1 aa in frame mutation)
DNA Base Change (assembly) GAACAACAACAA to GAACAACAA at 106891360 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000150100 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088687] [ENSMUST00000208759] [ENSMUST00000209025] [ENSMUST00000210644] [ENSMUST00000213251] [ENSMUST00000213918] [ENSMUST00000214112]
AlphaFold K7N662
Predicted Effect probably benign
Transcript: ENSMUST00000088687
SMART Domains Protein: ENSMUSP00000086062
Gene: ENSMUSG00000069390

Pfam:7tm_4 31 307 2.2e-58 PFAM
Pfam:7TM_GPCR_Srsx 35 303 9.1e-9 PFAM
Pfam:7tm_1 41 290 1.4e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000208759
Predicted Effect probably benign
Transcript: ENSMUST00000209025
Predicted Effect probably benign
Transcript: ENSMUST00000210644
Predicted Effect probably benign
Transcript: ENSMUST00000213251
Predicted Effect probably benign
Transcript: ENSMUST00000213918
Predicted Effect probably benign
Transcript: ENSMUST00000214112
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214495
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216085
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216099
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adrb2 T C 18: 62,179,056 I233V probably damaging Het
Alox5 T A 6: 116,460,963 Y21F possibly damaging Het
Ank2 T C 3: 126,946,149 T1942A probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Bckdk C T 7: 127,906,419 A238V probably benign Het
Casp1 A G 9: 5,299,333 T21A probably benign Het
Ccdc39 T C 3: 33,826,522 H432R probably benign Het
Cttnbp2 A C 6: 18,405,249 C574G probably damaging Het
Cyp1a1 T C 9: 57,700,149 V20A probably benign Het
Dhx38 C T 8: 109,553,131 V976I probably damaging Het
Dnah6 A G 6: 73,149,484 S1287P possibly damaging Het
Dnttip2 T C 3: 122,276,497 S454P probably damaging Het
Doxl2 T C 6: 48,976,130 S330P probably damaging Het
Drp2 A T X: 134,435,135 probably benign Het
Flcn C T 11: 59,803,784 V121I possibly damaging Het
Fmo1 G C 1: 162,833,648 Y355* probably null Het
Git2 T A 5: 114,764,666 H138L probably damaging Het
Gpr162 G A 6: 124,861,695 probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kcnt1 T C 2: 25,907,626 I881T probably damaging Het
Lama3 T A 18: 12,513,690 C1754S probably damaging Het
Mpp3 A T 11: 102,023,420 D116E probably benign Het
Myh11 T C 16: 14,218,883 D985G probably damaging Het
Necap1 T C 6: 122,887,378 V273A probably damaging Het
Nlrc5 T C 8: 94,476,564 S431P probably damaging Het
Nutm2 A T 13: 50,469,884 T206S probably benign Het
Olfr27 G A 9: 39,144,429 A110T probably damaging Het
Olfr507 C T 7: 108,621,889 L26F probably benign Het
Phactr2 A G 10: 13,253,820 S235P probably damaging Het
Podnl1 G A 8: 84,127,268 R89H probably benign Het
Prpf38b T C 3: 108,911,171 Y91C probably damaging Het
Radil C T 5: 142,494,805 A632T probably benign Het
Rpap2 G A 5: 107,601,795 V62I possibly damaging Het
Sdf2 C T 11: 78,251,037 T66I probably damaging Het
Specc1 T C 11: 62,118,530 S371P probably damaging Het
Suco T C 1: 161,847,230 E416G probably damaging Het
Sys1 T C 2: 164,461,395 W10R probably damaging Het
Tarsl2 C T 7: 65,682,819 T556M probably damaging Het
Tcirg1 C T 19: 3,899,069 D407N probably damaging Het
Tefm G T 11: 80,140,330 L27I probably benign Het
Tenm2 A G 11: 36,027,398 I1845T probably benign Het
Tfam A T 10: 71,233,403 I119N probably damaging Het
Tle1 ACAGGTTTCTTCAGGTTTCTT ACAGGTTTCTT 4: 72,118,163 probably benign Het
Trpm6 T C 19: 18,827,525 I947T probably damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Usp54 T C 14: 20,561,134 T1205A probably benign Het
Vmn2r25 T C 6: 123,828,537 R454G probably damaging Het
Xylb T C 9: 119,388,715 V477A probably benign Het
Other mutations in Olfr707
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02718:Olfr707 APN 7 106891329 missense probably damaging 1.00
R1539:Olfr707 UTSW 7 106891276 missense probably damaging 1.00
R1768:Olfr707 UTSW 7 106891977 splice site probably null
R1768:Olfr707 UTSW 7 106891978 missense probably damaging 0.97
R4542:Olfr707 UTSW 7 106891360 small deletion probably benign
R4874:Olfr707 UTSW 7 106891435 missense probably benign 0.28
R6164:Olfr707 UTSW 7 106891928 nonsense probably null
R8124:Olfr707 UTSW 7 106891881 missense possibly damaging 0.91
R8883:Olfr707 UTSW 7 106891329 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On 2015-07-06