Incidental Mutation 'R4367:Casp1'
Institutional Source Beutler Lab
Gene Symbol Casp1
Ensembl Gene ENSMUSG00000025888
Gene Namecaspase 1
SynonymsICE, Il1bc, Caspase-1, interleukin 1 beta-converting enzyme
MMRRC Submission 041673-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4367 (G1)
Quality Score225
Status Validated
Chromosomal Location5298517-5307265 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 5299333 bp
Amino Acid Change Threonine to Alanine at position 21 (T21A)
Ref Sequence ENSEMBL: ENSMUSP00000027015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027015]
Predicted Effect probably benign
Transcript: ENSMUST00000027015
AA Change: T21A

PolyPhen 2 Score 0.411 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000027015
Gene: ENSMUSG00000025888
AA Change: T21A

CARD 4 89 4.91e-19 SMART
CASc 151 400 1.82e-136 SMART
Meta Mutation Damage Score 0.3086 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is a member of the cysteine-aspartic acid protease (caspase) family. Sequential activation of caspases plays a central role in the execution-phase of cell apoptosis. Caspases exist as inactive proenzymes which undergo proteolytic processing at conserved aspartic residues to produce 2 subunits, large and small, that dimerize to form the active enzyme. This gene was identified by its ability to proteolytically cleave and activate the inactive precursor of interleukin-1, a cytokine involved in the processes such as inflammation, septic shock, and wound healing. This gene has been shown to induce cell apoptosis and may function in various developmental stages. Studies of a similar gene in mouse suggest a role in the pathogenesis of Huntington disease. Alternative splicing results in transcript variants encoding distinct isoforms. [provided by RefSeq, Mar 2012]
PHENOTYPE: Homozygous targeted mutants fail to produce mature IL1A and IL1B and are resistant to LPS-induced endotoxin shock and to FAS antibody-induced apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adrb2 T C 18: 62,179,056 I233V probably damaging Het
Alox5 T A 6: 116,460,963 Y21F possibly damaging Het
Ank2 T C 3: 126,946,149 T1942A probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Bckdk C T 7: 127,906,419 A238V probably benign Het
Ccdc39 T C 3: 33,826,522 H432R probably benign Het
Cttnbp2 A C 6: 18,405,249 C574G probably damaging Het
Cyp1a1 T C 9: 57,700,149 V20A probably benign Het
Dhx38 C T 8: 109,553,131 V976I probably damaging Het
Dnah6 A G 6: 73,149,484 S1287P possibly damaging Het
Dnttip2 T C 3: 122,276,497 S454P probably damaging Het
Doxl2 T C 6: 48,976,130 S330P probably damaging Het
Drp2 A T X: 134,435,135 probably benign Het
Flcn C T 11: 59,803,784 V121I possibly damaging Het
Fmo1 G C 1: 162,833,648 Y355* probably null Het
Git2 T A 5: 114,764,666 H138L probably damaging Het
Gpr162 G A 6: 124,861,695 probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kcnt1 T C 2: 25,907,626 I881T probably damaging Het
Lama3 T A 18: 12,513,690 C1754S probably damaging Het
Mpp3 A T 11: 102,023,420 D116E probably benign Het
Myh11 T C 16: 14,218,883 D985G probably damaging Het
Necap1 T C 6: 122,887,378 V273A probably damaging Het
Nlrc5 T C 8: 94,476,564 S431P probably damaging Het
Nutm2 A T 13: 50,469,884 T206S probably benign Het
Olfr27 G A 9: 39,144,429 A110T probably damaging Het
Olfr507 C T 7: 108,621,889 L26F probably benign Het
Olfr707 GAACAACAACAA GAACAACAA 7: 106,891,360 probably benign Het
Phactr2 A G 10: 13,253,820 S235P probably damaging Het
Podnl1 G A 8: 84,127,268 R89H probably benign Het
Prpf38b T C 3: 108,911,171 Y91C probably damaging Het
Radil C T 5: 142,494,805 A632T probably benign Het
Rpap2 G A 5: 107,601,795 V62I possibly damaging Het
Sdf2 C T 11: 78,251,037 T66I probably damaging Het
Specc1 T C 11: 62,118,530 S371P probably damaging Het
Suco T C 1: 161,847,230 E416G probably damaging Het
Sys1 T C 2: 164,461,395 W10R probably damaging Het
Tarsl2 C T 7: 65,682,819 T556M probably damaging Het
Tcirg1 C T 19: 3,899,069 D407N probably damaging Het
Tefm G T 11: 80,140,330 L27I probably benign Het
Tenm2 A G 11: 36,027,398 I1845T probably benign Het
Tfam A T 10: 71,233,403 I119N probably damaging Het
Tle1 ACAGGTTTCTTCAGGTTTCTT ACAGGTTTCTT 4: 72,118,163 probably benign Het
Trpm6 T C 19: 18,827,525 I947T probably damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Usp54 T C 14: 20,561,134 T1205A probably benign Het
Vmn2r25 T C 6: 123,828,537 R454G probably damaging Het
Xylb T C 9: 119,388,715 V477A probably benign Het
Other mutations in Casp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Casp1 APN 9 5299872 splice site probably benign
IGL00667:Casp1 APN 9 5303756 missense probably benign 0.40
IGL01998:Casp1 APN 9 5303043 missense probably damaging 1.00
IGL02248:Casp1 APN 9 5299452 missense probably benign 0.01
IGL02469:Casp1 APN 9 5303105 missense probably benign 0.19
P0027:Casp1 UTSW 9 5299851 missense probably benign 0.00
PIT4305001:Casp1 UTSW 9 5306135 missense probably benign 0.03
R0724:Casp1 UTSW 9 5303077 missense probably benign
R1169:Casp1 UTSW 9 5299454 missense possibly damaging 0.93
R1876:Casp1 UTSW 9 5303663 missense probably benign 0.01
R2316:Casp1 UTSW 9 5306213 missense possibly damaging 0.92
R2877:Casp1 UTSW 9 5303110 missense probably damaging 1.00
R2885:Casp1 UTSW 9 5299851 missense probably benign 0.00
R4043:Casp1 UTSW 9 5302444 missense probably benign
R4656:Casp1 UTSW 9 5304324 missense probably damaging 1.00
R4705:Casp1 UTSW 9 5306204 missense probably damaging 1.00
R4790:Casp1 UTSW 9 5303020 missense probably benign 0.01
R4858:Casp1 UTSW 9 5306742 missense probably damaging 1.00
R5607:Casp1 UTSW 9 5303143 missense probably damaging 1.00
R5784:Casp1 UTSW 9 5299337 missense probably damaging 0.98
R6578:Casp1 UTSW 9 5304280 missense probably benign 0.04
R7111:Casp1 UTSW 9 5299816 missense probably benign 0.01
R7215:Casp1 UTSW 9 5298523 utr 5 prime probably null
R7590:Casp1 UTSW 9 5306710 missense probably damaging 1.00
R8002:Casp1 UTSW 9 5303164 missense possibly damaging 0.94
T0722:Casp1 UTSW 9 5299851 missense probably benign 0.00
X0003:Casp1 UTSW 9 5299851 missense probably benign 0.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On2015-07-06