Incidental Mutation 'R4367:Phactr2'
Institutional Source Beutler Lab
Gene Symbol Phactr2
Ensembl Gene ENSMUSG00000062866
Gene Namephosphatase and actin regulator 2
MMRRC Submission 041673-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4367 (G1)
Quality Score225
Status Validated
Chromosomal Location13207717-13474412 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 13253820 bp
Amino Acid Change Serine to Proline at position 235 (S235P)
Ref Sequence ENSEMBL: ENSMUSP00000101184 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079698] [ENSMUST00000105543] [ENSMUST00000105545] [ENSMUST00000105546]
Predicted Effect probably damaging
Transcript: ENSMUST00000079698
AA Change: S165P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000078637
Gene: ENSMUSG00000062866
AA Change: S165P

low complexity region 39 54 N/A INTRINSIC
RPEL 60 85 7.44e-6 SMART
low complexity region 154 179 N/A INTRINSIC
low complexity region 208 218 N/A INTRINSIC
low complexity region 250 270 N/A INTRINSIC
low complexity region 378 388 N/A INTRINSIC
RPEL 403 428 5.81e-8 SMART
RPEL 441 466 1.36e-8 SMART
RPEL 479 504 1.64e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105543
AA Change: S172P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101182
Gene: ENSMUSG00000062866
AA Change: S172P

low complexity region 50 65 N/A INTRINSIC
RPEL 71 96 7.44e-6 SMART
low complexity region 165 190 N/A INTRINSIC
low complexity region 219 229 N/A INTRINSIC
low complexity region 261 281 N/A INTRINSIC
low complexity region 389 399 N/A INTRINSIC
RPEL 414 439 5.81e-8 SMART
RPEL 452 477 1.36e-8 SMART
RPEL 490 515 1.64e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105545
AA Change: S235P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101184
Gene: ENSMUSG00000062866
AA Change: S235P

low complexity region 50 65 N/A INTRINSIC
RPEL 71 96 7.44e-6 SMART
low complexity region 157 182 N/A INTRINSIC
low complexity region 211 221 N/A INTRINSIC
low complexity region 253 273 N/A INTRINSIC
low complexity region 381 391 N/A INTRINSIC
RPEL 406 431 5.81e-8 SMART
RPEL 444 469 1.36e-8 SMART
RPEL 482 507 1.64e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105546
AA Change: S241P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101185
Gene: ENSMUSG00000062866
AA Change: S241P

low complexity region 39 54 N/A INTRINSIC
RPEL 60 85 7.44e-6 SMART
low complexity region 133 144 N/A INTRINSIC
low complexity region 149 184 N/A INTRINSIC
low complexity region 199 213 N/A INTRINSIC
low complexity region 226 251 N/A INTRINSIC
low complexity region 280 290 N/A INTRINSIC
low complexity region 322 342 N/A INTRINSIC
low complexity region 450 460 N/A INTRINSIC
RPEL 475 500 5.81e-8 SMART
RPEL 513 538 1.36e-8 SMART
RPEL 551 576 1.64e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105547
AA Change: S239P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101186
Gene: ENSMUSG00000062866
AA Change: S239P

low complexity region 12 36 N/A INTRINSIC
low complexity region 50 65 N/A INTRINSIC
low complexity region 109 124 N/A INTRINSIC
RPEL 130 155 7.44e-6 SMART
low complexity region 224 249 N/A INTRINSIC
low complexity region 278 288 N/A INTRINSIC
low complexity region 320 340 N/A INTRINSIC
low complexity region 448 458 N/A INTRINSIC
RPEL 473 498 5.81e-8 SMART
RPEL 511 536 1.36e-8 SMART
RPEL 549 574 1.64e-7 SMART
Meta Mutation Damage Score 0.0661 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adrb2 T C 18: 62,179,056 I233V probably damaging Het
Alox5 T A 6: 116,460,963 Y21F possibly damaging Het
Ank2 T C 3: 126,946,149 T1942A probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Bckdk C T 7: 127,906,419 A238V probably benign Het
Casp1 A G 9: 5,299,333 T21A probably benign Het
Ccdc39 T C 3: 33,826,522 H432R probably benign Het
Cttnbp2 A C 6: 18,405,249 C574G probably damaging Het
Cyp1a1 T C 9: 57,700,149 V20A probably benign Het
Dhx38 C T 8: 109,553,131 V976I probably damaging Het
Dnah6 A G 6: 73,149,484 S1287P possibly damaging Het
Dnttip2 T C 3: 122,276,497 S454P probably damaging Het
Doxl2 T C 6: 48,976,130 S330P probably damaging Het
Drp2 A T X: 134,435,135 probably benign Het
Flcn C T 11: 59,803,784 V121I possibly damaging Het
Fmo1 G C 1: 162,833,648 Y355* probably null Het
Git2 T A 5: 114,764,666 H138L probably damaging Het
Gpr162 G A 6: 124,861,695 probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kcnt1 T C 2: 25,907,626 I881T probably damaging Het
Lama3 T A 18: 12,513,690 C1754S probably damaging Het
Mpp3 A T 11: 102,023,420 D116E probably benign Het
Myh11 T C 16: 14,218,883 D985G probably damaging Het
Necap1 T C 6: 122,887,378 V273A probably damaging Het
Nlrc5 T C 8: 94,476,564 S431P probably damaging Het
Nutm2 A T 13: 50,469,884 T206S probably benign Het
Olfr27 G A 9: 39,144,429 A110T probably damaging Het
Olfr507 C T 7: 108,621,889 L26F probably benign Het
Olfr707 GAACAACAACAA GAACAACAA 7: 106,891,360 probably benign Het
Podnl1 G A 8: 84,127,268 R89H probably benign Het
Prpf38b T C 3: 108,911,171 Y91C probably damaging Het
Radil C T 5: 142,494,805 A632T probably benign Het
Rpap2 G A 5: 107,601,795 V62I possibly damaging Het
Sdf2 C T 11: 78,251,037 T66I probably damaging Het
Specc1 T C 11: 62,118,530 S371P probably damaging Het
Suco T C 1: 161,847,230 E416G probably damaging Het
Sys1 T C 2: 164,461,395 W10R probably damaging Het
Tarsl2 C T 7: 65,682,819 T556M probably damaging Het
Tcirg1 C T 19: 3,899,069 D407N probably damaging Het
Tefm G T 11: 80,140,330 L27I probably benign Het
Tenm2 A G 11: 36,027,398 I1845T probably benign Het
Tfam A T 10: 71,233,403 I119N probably damaging Het
Tle1 ACAGGTTTCTTCAGGTTTCTT ACAGGTTTCTT 4: 72,118,163 probably benign Het
Trpm6 T C 19: 18,827,525 I947T probably damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Usp54 T C 14: 20,561,134 T1205A probably benign Het
Vmn2r25 T C 6: 123,828,537 R454G probably damaging Het
Xylb T C 9: 119,388,715 V477A probably benign Het
Other mutations in Phactr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Phactr2 APN 10 13245535 missense probably damaging 1.00
IGL01844:Phactr2 APN 10 13253437 missense probably benign 0.05
IGL01893:Phactr2 APN 10 13247188 missense probably benign 0.38
IGL02458:Phactr2 APN 10 13261828 missense probably damaging 1.00
IGL02612:Phactr2 APN 10 13245423 missense probably damaging 0.99
IGL02620:Phactr2 APN 10 13291888 missense probably damaging 1.00
IGL03064:Phactr2 APN 10 13388713 utr 5 prime probably benign
IGL03493:Phactr2 APN 10 13257669 missense probably benign 0.02
R0973:Phactr2 UTSW 10 13247139 missense possibly damaging 0.88
R0973:Phactr2 UTSW 10 13247139 missense possibly damaging 0.88
R0974:Phactr2 UTSW 10 13247139 missense possibly damaging 0.88
R1480:Phactr2 UTSW 10 13253792 missense possibly damaging 0.74
R3115:Phactr2 UTSW 10 13261901 nonsense probably null
R3116:Phactr2 UTSW 10 13261901 nonsense probably null
R3713:Phactr2 UTSW 10 13388732 start gained probably benign
R4368:Phactr2 UTSW 10 13253820 missense probably damaging 1.00
R4371:Phactr2 UTSW 10 13253820 missense probably damaging 1.00
R5344:Phactr2 UTSW 10 13253616 missense possibly damaging 0.76
R5491:Phactr2 UTSW 10 13261846 missense possibly damaging 0.91
R5617:Phactr2 UTSW 10 13474065 missense possibly damaging 0.60
R5656:Phactr2 UTSW 10 13388703 missense probably benign 0.34
R5895:Phactr2 UTSW 10 13245517 missense probably damaging 1.00
R6051:Phactr2 UTSW 10 13261811 unclassified probably null 0.00
R6317:Phactr2 UTSW 10 13261882 missense probably damaging 0.98
R7048:Phactr2 UTSW 10 13245424 missense probably benign 0.28
R7101:Phactr2 UTSW 10 13247178 missense probably benign 0.00
R7221:Phactr2 UTSW 10 13247039 missense possibly damaging 0.58
R7868:Phactr2 UTSW 10 13232609 missense probably damaging 1.00
R7951:Phactr2 UTSW 10 13232609 missense probably damaging 1.00
RF023:Phactr2 UTSW 10 13245434 missense probably benign 0.10
X0026:Phactr2 UTSW 10 13257634 nonsense probably null
Predicted Primers PCR Primer

Sequencing Primer
Posted On2015-07-06