Incidental Mutation 'R4367:Tenm2'
Institutional Source Beutler Lab
Gene Symbol Tenm2
Ensembl Gene ENSMUSG00000049336
Gene Nameteneurin transmembrane protein 2
Synonyms2610040L17Rik, 9330187F13Rik, D3Bwg1534e, Ten-m2, Odz2
MMRRC Submission 041673-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.515) question?
Stock #R4367 (G1)
Quality Score225
Status Validated
Chromosomal Location36006656-37235964 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36027398 bp
Amino Acid Change Isoleucine to Threonine at position 1845 (I1845T)
Ref Sequence ENSEMBL: ENSMUSP00000129951 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057207] [ENSMUST00000102801] [ENSMUST00000163524]
Predicted Effect probably benign
Transcript: ENSMUST00000057207
AA Change: I1846T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000052014
Gene: ENSMUSG00000049336
AA Change: I1846T

Pfam:Ten_N 10 374 4.9e-177 PFAM
transmembrane domain 375 397 N/A INTRINSIC
EGF 575 603 5.62e0 SMART
EGF_like 606 634 4.93e1 SMART
EGF 639 668 1.76e1 SMART
EGF 671 700 1.43e-1 SMART
EGF 705 735 1.2e1 SMART
EGF 738 766 9.63e0 SMART
EGF 769 797 1.25e1 SMART
EGF 800 832 1.4e0 SMART
low complexity region 1459 1475 N/A INTRINSIC
low complexity region 2219 2230 N/A INTRINSIC
Pfam:Tox-GHH 2681 2758 1.4e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102801
AA Change: I1845T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000099865
Gene: ENSMUSG00000049336
AA Change: I1845T

Pfam:Ten_N 9 374 2e-186 PFAM
transmembrane domain 375 397 N/A INTRINSIC
EGF 575 603 5.62e0 SMART
EGF_like 606 634 4.93e1 SMART
EGF 639 668 1.76e1 SMART
EGF 671 700 1.43e-1 SMART
EGF 705 735 1.2e1 SMART
EGF 737 765 9.63e0 SMART
EGF 768 796 1.25e1 SMART
EGF 799 831 1.4e0 SMART
low complexity region 1458 1474 N/A INTRINSIC
low complexity region 2218 2229 N/A INTRINSIC
Pfam:Tox-GHH 2679 2757 2e-34 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163524
AA Change: I1845T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129951
Gene: ENSMUSG00000049336
AA Change: I1845T

Pfam:Ten_N 9 374 2e-186 PFAM
transmembrane domain 375 397 N/A INTRINSIC
EGF 575 603 5.62e0 SMART
EGF_like 606 634 4.93e1 SMART
EGF 639 668 1.76e1 SMART
EGF 671 700 1.43e-1 SMART
EGF 705 735 1.2e1 SMART
EGF 737 765 9.63e0 SMART
EGF 768 796 1.25e1 SMART
EGF 799 831 1.4e0 SMART
low complexity region 1458 1474 N/A INTRINSIC
low complexity region 2218 2229 N/A INTRINSIC
Pfam:Tox-GHH 2679 2757 2e-34 PFAM
Meta Mutation Damage Score 0.0590 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 98% (54/55)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele show abnormalities in the laterality and mapping of ipsilateral retinal projections that lead to loss of ipsilateral drive, defects in binocular vision, and impaired performance on a visual discrimination task. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adrb2 T C 18: 62,179,056 I233V probably damaging Het
Alox5 T A 6: 116,460,963 Y21F possibly damaging Het
Ank2 T C 3: 126,946,149 T1942A probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Bckdk C T 7: 127,906,419 A238V probably benign Het
Casp1 A G 9: 5,299,333 T21A probably benign Het
Ccdc39 T C 3: 33,826,522 H432R probably benign Het
Cttnbp2 A C 6: 18,405,249 C574G probably damaging Het
Cyp1a1 T C 9: 57,700,149 V20A probably benign Het
Dhx38 C T 8: 109,553,131 V976I probably damaging Het
Dnah6 A G 6: 73,149,484 S1287P possibly damaging Het
Dnttip2 T C 3: 122,276,497 S454P probably damaging Het
Doxl2 T C 6: 48,976,130 S330P probably damaging Het
Drp2 A T X: 134,435,135 probably benign Het
Flcn C T 11: 59,803,784 V121I possibly damaging Het
Fmo1 G C 1: 162,833,648 Y355* probably null Het
Git2 T A 5: 114,764,666 H138L probably damaging Het
Gpr162 G A 6: 124,861,695 probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kcnt1 T C 2: 25,907,626 I881T probably damaging Het
Lama3 T A 18: 12,513,690 C1754S probably damaging Het
Mpp3 A T 11: 102,023,420 D116E probably benign Het
Myh11 T C 16: 14,218,883 D985G probably damaging Het
Necap1 T C 6: 122,887,378 V273A probably damaging Het
Nlrc5 T C 8: 94,476,564 S431P probably damaging Het
Nutm2 A T 13: 50,469,884 T206S probably benign Het
Olfr27 G A 9: 39,144,429 A110T probably damaging Het
Olfr507 C T 7: 108,621,889 L26F probably benign Het
Olfr707 GAACAACAACAA GAACAACAA 7: 106,891,360 probably benign Het
Phactr2 A G 10: 13,253,820 S235P probably damaging Het
Podnl1 G A 8: 84,127,268 R89H probably benign Het
Prpf38b T C 3: 108,911,171 Y91C probably damaging Het
Radil C T 5: 142,494,805 A632T probably benign Het
Rpap2 G A 5: 107,601,795 V62I possibly damaging Het
Sdf2 C T 11: 78,251,037 T66I probably damaging Het
Specc1 T C 11: 62,118,530 S371P probably damaging Het
Suco T C 1: 161,847,230 E416G probably damaging Het
Sys1 T C 2: 164,461,395 W10R probably damaging Het
Tarsl2 C T 7: 65,682,819 T556M probably damaging Het
Tcirg1 C T 19: 3,899,069 D407N probably damaging Het
Tefm G T 11: 80,140,330 L27I probably benign Het
Tfam A T 10: 71,233,403 I119N probably damaging Het
Tle1 ACAGGTTTCTTCAGGTTTCTT ACAGGTTTCTT 4: 72,118,163 probably benign Het
Trpm6 T C 19: 18,827,525 I947T probably damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Usp54 T C 14: 20,561,134 T1205A probably benign Het
Vmn2r25 T C 6: 123,828,537 R454G probably damaging Het
Xylb T C 9: 119,388,715 V477A probably benign Het
Other mutations in Tenm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00161:Tenm2 APN 11 36206899 splice site probably benign
IGL00834:Tenm2 APN 11 36024258 missense probably damaging 1.00
IGL00911:Tenm2 APN 11 36008733 nonsense probably null
IGL00937:Tenm2 APN 11 36024623 missense probably damaging 1.00
IGL01154:Tenm2 APN 11 36041544 missense probably damaging 1.00
IGL01313:Tenm2 APN 11 36024248 missense probably damaging 0.98
IGL01346:Tenm2 APN 11 36027405 nonsense probably null
IGL01539:Tenm2 APN 11 36106827 missense possibly damaging 0.89
IGL01629:Tenm2 APN 11 36864884 missense probably damaging 0.98
IGL01780:Tenm2 APN 11 36046941 missense probably benign
IGL01821:Tenm2 APN 11 36023883 missense probably damaging 0.98
IGL01988:Tenm2 APN 11 36027251 missense probably damaging 1.00
IGL02002:Tenm2 APN 11 36207095 missense probably benign
IGL02449:Tenm2 APN 11 36023622 missense probably damaging 0.99
IGL02505:Tenm2 APN 11 36051916 nonsense probably null
IGL02649:Tenm2 APN 11 36207085 missense possibly damaging 0.85
IGL02688:Tenm2 APN 11 36068458 missense probably benign 0.05
IGL02801:Tenm2 APN 11 36047030 nonsense probably null
IGL02928:Tenm2 APN 11 36027170 missense possibly damaging 0.69
IGL02940:Tenm2 APN 11 36041644 missense probably damaging 1.00
IGL03202:Tenm2 APN 11 36024548 missense probably damaging 1.00
IGL03213:Tenm2 APN 11 36023330 missense probably benign 0.05
IGL03276:Tenm2 APN 11 36072776 missense possibly damaging 0.95
IGL03296:Tenm2 APN 11 36052025 splice site probably null
IGL03381:Tenm2 APN 11 36068411 missense probably benign 0.01
IGL03398:Tenm2 APN 11 36024543 missense probably damaging 1.00
browser UTSW 11 36046765 critical splice donor site probably null
mosaic UTSW 11 36063775 critical splice donor site probably null
IGL02799:Tenm2 UTSW 11 36273408 missense probably damaging 1.00
PIT4260001:Tenm2 UTSW 11 36163730 missense probably damaging 1.00
PIT4382001:Tenm2 UTSW 11 36063902 missense probably damaging 0.99
R0004:Tenm2 UTSW 11 36023357 missense probably damaging 1.00
R0420:Tenm2 UTSW 11 36207124 splice site probably benign
R0537:Tenm2 UTSW 11 36163730 missense probably damaging 1.00
R0599:Tenm2 UTSW 11 36024780 missense possibly damaging 0.93
R0636:Tenm2 UTSW 11 36943976 missense probably damaging 1.00
R0693:Tenm2 UTSW 11 36024809 missense probably damaging 1.00
R0991:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R0992:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1167:Tenm2 UTSW 11 36864684 missense probably benign 0.30
R1177:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1178:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1179:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1180:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1181:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1193:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1194:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1195:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1195:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1195:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1259:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1265:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1267:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1268:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1269:Tenm2 UTSW 11 36008358 missense possibly damaging 0.64
R1270:Tenm2 UTSW 11 36041659 missense probably damaging 1.00
R1272:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1273:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1311:Tenm2 UTSW 11 36068594 splice site probably benign
R1374:Tenm2 UTSW 11 36008454 missense probably benign 0.00
R1542:Tenm2 UTSW 11 36300220 missense probably damaging 0.99
R1573:Tenm2 UTSW 11 36047069 missense probably damaging 1.00
R1579:Tenm2 UTSW 11 36106783 missense probably damaging 1.00
R1697:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1722:Tenm2 UTSW 11 36008103 missense probably damaging 1.00
R1756:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1793:Tenm2 UTSW 11 36023382 missense probably damaging 0.99
R1950:Tenm2 UTSW 11 36063177 missense possibly damaging 0.94
R1954:Tenm2 UTSW 11 36047547 missense possibly damaging 0.87
R2025:Tenm2 UTSW 11 36047264 nonsense probably null
R2117:Tenm2 UTSW 11 36024854 missense probably damaging 1.00
R2244:Tenm2 UTSW 11 36864862 missense probably damaging 0.98
R2298:Tenm2 UTSW 11 36046777 missense possibly damaging 0.62
R2432:Tenm2 UTSW 11 36027191 missense probably damaging 1.00
R3014:Tenm2 UTSW 11 36023973 missense probably damaging 1.00
R3115:Tenm2 UTSW 11 36023366 missense probably damaging 1.00
R3684:Tenm2 UTSW 11 36051817 missense probably benign 0.00
R3685:Tenm2 UTSW 11 36051817 missense probably benign 0.00
R3705:Tenm2 UTSW 11 36068326 missense probably damaging 0.97
R3820:Tenm2 UTSW 11 36024320 missense probably damaging 0.98
R3821:Tenm2 UTSW 11 36024320 missense probably damaging 0.98
R3822:Tenm2 UTSW 11 36024320 missense probably damaging 0.98
R3844:Tenm2 UTSW 11 36047538 missense probably damaging 0.98
R3878:Tenm2 UTSW 11 36139574 critical splice donor site probably null
R4019:Tenm2 UTSW 11 36047074 missense probably benign 0.04
R4062:Tenm2 UTSW 11 36008655 missense probably damaging 1.00
R4395:Tenm2 UTSW 11 36024624 missense probably benign 0.23
R4508:Tenm2 UTSW 11 36008345 missense possibly damaging 0.82
R4534:Tenm2 UTSW 11 36063104 missense possibly damaging 0.64
R4539:Tenm2 UTSW 11 36046780 missense probably damaging 1.00
R4644:Tenm2 UTSW 11 36047136 missense probably benign 0.00
R4661:Tenm2 UTSW 11 36024448 missense probably damaging 0.99
R4669:Tenm2 UTSW 11 36010487 missense probably damaging 1.00
R4687:Tenm2 UTSW 11 36049097 missense probably benign
R4711:Tenm2 UTSW 11 36300212 missense probably damaging 0.98
R4816:Tenm2 UTSW 11 36027290 missense probably damaging 1.00
R4843:Tenm2 UTSW 11 36024020 missense probably damaging 1.00
R4850:Tenm2 UTSW 11 36023488 nonsense probably null
R4870:Tenm2 UTSW 11 36078569 missense probably damaging 1.00
R5058:Tenm2 UTSW 11 36207080 missense possibly damaging 0.80
R5071:Tenm2 UTSW 11 36068381 missense probably damaging 0.99
R5073:Tenm2 UTSW 11 36068381 missense probably damaging 0.99
R5074:Tenm2 UTSW 11 36068381 missense probably damaging 0.99
R5081:Tenm2 UTSW 11 36024633 missense possibly damaging 0.95
R5093:Tenm2 UTSW 11 36944162 missense probably damaging 1.00
R5170:Tenm2 UTSW 11 36024806 missense probably damaging 0.98
R5253:Tenm2 UTSW 11 36047201 nonsense probably null
R5343:Tenm2 UTSW 11 36069503 missense probably benign 0.00
R5493:Tenm2 UTSW 11 36864676 missense probably benign 0.01
R5600:Tenm2 UTSW 11 36163714 splice site probably null
R5677:Tenm2 UTSW 11 36141683 missense probably damaging 0.98
R5703:Tenm2 UTSW 11 36023799 missense probably benign 0.34
R5707:Tenm2 UTSW 11 36047182 missense possibly damaging 0.79
R6026:Tenm2 UTSW 11 36072729 critical splice donor site probably null
R6063:Tenm2 UTSW 11 36163717 critical splice donor site probably null
R6086:Tenm2 UTSW 11 36008646 missense possibly damaging 0.64
R6151:Tenm2 UTSW 11 36008783 missense probably damaging 1.00
R6169:Tenm2 UTSW 11 36139690 missense probably damaging 0.99
R6193:Tenm2 UTSW 11 36046794 missense probably damaging 1.00
R6405:Tenm2 UTSW 11 36864859 missense probably benign 0.44
R6477:Tenm2 UTSW 11 36010507 critical splice acceptor site probably null
R6607:Tenm2 UTSW 11 36063775 critical splice donor site probably null
R6668:Tenm2 UTSW 11 36046765 critical splice donor site probably null
R6825:Tenm2 UTSW 11 36046884 missense probably benign 0.02
R6885:Tenm2 UTSW 11 36023580 missense possibly damaging 0.95
R7017:Tenm2 UTSW 11 36171409 missense probably damaging 0.98
R7115:Tenm2 UTSW 11 36163817 missense probably damaging 0.99
R7153:Tenm2 UTSW 11 36024182 missense probably damaging 0.98
R7173:Tenm2 UTSW 11 36041551 missense probably damaging 0.99
R7199:Tenm2 UTSW 11 36171436 missense probably damaging 1.00
R7205:Tenm2 UTSW 11 36049129 missense probably damaging 0.99
R7250:Tenm2 UTSW 11 36072798 missense probably damaging 1.00
R7290:Tenm2 UTSW 11 36023471 missense probably damaging 1.00
R7366:Tenm2 UTSW 11 36069414 missense probably benign 0.09
R7432:Tenm2 UTSW 11 36864941 missense probably benign
R7504:Tenm2 UTSW 11 36139743 missense probably damaging 1.00
R7513:Tenm2 UTSW 11 36051900 missense probably benign 0.34
R7523:Tenm2 UTSW 11 36078581 splice site probably null
R7527:Tenm2 UTSW 11 36206976 missense probably damaging 1.00
R7648:Tenm2 UTSW 11 36106736 missense probably damaging 1.00
R7653:Tenm2 UTSW 11 36047347 missense probably benign 0.09
R7717:Tenm2 UTSW 11 36864935 missense probably damaging 0.97
R7739:Tenm2 UTSW 11 36069561 missense possibly damaging 0.50
R7762:Tenm2 UTSW 11 36023306 missense possibly damaging 0.74
R7786:Tenm2 UTSW 11 36010449 missense probably damaging 0.99
R7803:Tenm2 UTSW 11 36047116 missense probably damaging 0.98
R7834:Tenm2 UTSW 11 36024854 missense probably damaging 1.00
R7838:Tenm2 UTSW 11 36106799 missense probably benign 0.02
R8073:Tenm2 UTSW 11 36139644 missense possibly damaging 0.56
R8076:Tenm2 UTSW 11 36027221 missense probably benign 0.23
R8109:Tenm2 UTSW 11 36008310 missense probably benign
R8306:Tenm2 UTSW 11 36069369 missense possibly damaging 0.52
R8352:Tenm2 UTSW 11 36023601 missense probably damaging 0.98
R8452:Tenm2 UTSW 11 36023601 missense probably damaging 0.98
R8864:Tenm2 UTSW 11 36027195 missense possibly damaging 0.95
R8880:Tenm2 UTSW 11 36051961 missense probably damaging 0.99
R8943:Tenm2 UTSW 11 36944034 missense probably damaging 0.98
RF021:Tenm2 UTSW 11 36024203 missense possibly damaging 0.95
X0018:Tenm2 UTSW 11 36024200 missense probably damaging 1.00
X0063:Tenm2 UTSW 11 36024730 missense probably benign
Z1088:Tenm2 UTSW 11 36273267 missense probably damaging 1.00
Z1177:Tenm2 UTSW 11 36008234 missense possibly damaging 0.95
Z1177:Tenm2 UTSW 11 36300335 missense probably damaging 0.98
Z1177:Tenm2 UTSW 11 36385130 missense probably benign 0.01
Predicted Primers PCR Primer

Sequencing Primer
Posted On2015-07-06