Incidental Mutation 'R4368:Trim45'
ID325840
Institutional Source Beutler Lab
Gene Symbol Trim45
Ensembl Gene ENSMUSG00000033233
Gene Nametripartite motif-containing 45
Synonyms4921530N01Rik
MMRRC Submission 041115-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4368 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location100922202-100936920 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100923186 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 92 (I92T)
Ref Sequence ENSEMBL: ENSMUSP00000115669 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037409] [ENSMUST00000094048] [ENSMUST00000106980] [ENSMUST00000134993]
Predicted Effect probably damaging
Transcript: ENSMUST00000037409
AA Change: I92T

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000043389
Gene: ENSMUSG00000033233
AA Change: I92T

DomainStartEndE-ValueType
RING 29 97 5.35e-5 SMART
BBOX 130 176 1.03e-1 SMART
BBOX 186 227 4.34e-5 SMART
BBC 234 360 3.55e-9 SMART
IG_FLMN 398 500 7.63e-33 SMART
low complexity region 532 549 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000094048
AA Change: I43T

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000091590
Gene: ENSMUSG00000033233
AA Change: I43T

DomainStartEndE-ValueType
BBOX 81 127 1.03e-1 SMART
BBOX 137 178 4.34e-5 SMART
BBC 185 311 3.55e-9 SMART
IG_FLMN 349 451 7.63e-33 SMART
low complexity region 483 500 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106980
AA Change: I92T

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000102593
Gene: ENSMUSG00000033233
AA Change: I92T

DomainStartEndE-ValueType
RING 29 97 5.35e-5 SMART
BBOX 130 176 1.03e-1 SMART
BBOX 186 227 4.34e-5 SMART
BBC 234 360 3.55e-9 SMART
IG_FLMN 398 500 7.63e-33 SMART
low complexity region 532 549 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000134993
AA Change: I92T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115669
Gene: ENSMUSG00000033233
AA Change: I92T

DomainStartEndE-ValueType
RING 29 97 5.35e-5 SMART
BBOX 130 176 1.03e-1 SMART
BBOX 186 227 4.34e-5 SMART
BBC 234 360 3.55e-9 SMART
IG_FLMN 398 500 7.63e-33 SMART
Meta Mutation Damage Score 0.5302 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tripartite motif family. The encoded protein may function as a transcriptional repressor of the mitogen-activated protein kinase pathway. Alternatively spliced transcript variants have been described.[provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449A18Rik A G 3: 59,846,778 noncoding transcript Het
4932438A13Rik C T 3: 36,988,147 Q2761* probably null Het
Adamts7 G A 9: 90,195,851 probably null Het
Adgrv1 A C 13: 81,492,910 S3335R unknown Het
Armc6 G A 8: 70,225,293 L129F probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Cdh19 G A 1: 110,889,712 Q767* probably null Het
Cep120 G A 18: 53,685,885 probably null Het
Dhx38 C T 8: 109,553,131 V976I probably damaging Het
Efr3a T A 15: 65,866,780 F753I possibly damaging Het
Gm5538 T C 3: 59,751,966 F280S probably damaging Het
Hspb7 A T 4: 141,424,018 E157V probably damaging Het
Irx6 A G 8: 92,678,401 E299G probably damaging Het
Jhy T A 9: 40,917,144 N489Y possibly damaging Het
Klhl22 T C 16: 17,789,273 V481A possibly damaging Het
Mapk13 A G 17: 28,777,565 probably null Het
Meis1 A T 11: 19,010,656 probably benign Het
Nlrp14 A G 7: 107,197,805 K301E probably benign Het
Nol10 T C 12: 17,379,292 Y340H probably damaging Het
Olfr267 T C 4: 58,785,153 S190G probably benign Het
Paqr3 T C 5: 97,108,291 S75G probably damaging Het
Pdgfa T C 5: 138,986,306 T113A probably damaging Het
Phactr2 A G 10: 13,253,820 S235P probably damaging Het
Psph T G 5: 129,771,590 K9T probably benign Het
Ptpn21 T C 12: 98,678,593 Y1163C probably damaging Het
Scaf8 T C 17: 3,171,195 L319P unknown Het
Slc4a7 C T 14: 14,733,775 R62W probably damaging Het
Slc6a3 C A 13: 73,560,912 C318* probably null Het
Speer3 C G 5: 13,796,380 A238G possibly damaging Het
Taf1c A C 8: 119,599,316 S602R possibly damaging Het
Tiam2 A G 17: 3,414,683 D229G probably benign Het
Tor1a A G 2: 30,967,370 probably benign Het
Ttll8 G A 15: 88,914,181 P784S possibly damaging Het
Tubg1 G T 11: 101,125,364 probably null Het
Vmn1r178 A T 7: 23,894,022 N92I probably damaging Het
Vmn2r87 A G 10: 130,479,807 V130A probably benign Het
Wdr46 A G 17: 33,941,146 probably benign Het
Yme1l1 A G 2: 23,160,211 H18R possibly damaging Het
Zfp263 T A 16: 3,744,906 probably benign Het
Zfp534 T C 4: 147,675,558 D218G probably benign Het
Zscan12 T C 13: 21,369,383 V459A probably benign Het
Other mutations in Trim45
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00802:Trim45 APN 3 100931726 intron probably benign
IGL01472:Trim45 APN 3 100928065 missense probably benign 0.00
IGL01996:Trim45 APN 3 100928109 nonsense probably null 0.00
IGL02392:Trim45 APN 3 100925305 missense probably benign 0.04
IGL03229:Trim45 APN 3 100923069 missense probably damaging 1.00
IGL02837:Trim45 UTSW 3 100931627 intron probably benign
R0021:Trim45 UTSW 3 100925420 missense probably damaging 1.00
R0243:Trim45 UTSW 3 100929844 missense probably benign 0.05
R0501:Trim45 UTSW 3 100923219 missense probably damaging 1.00
R1222:Trim45 UTSW 3 100927298 missense probably benign 0.14
R1418:Trim45 UTSW 3 100927298 missense probably benign 0.14
R1813:Trim45 UTSW 3 100922967 missense probably benign 0.16
R2148:Trim45 UTSW 3 100932044 nonsense probably null
R2383:Trim45 UTSW 3 100925227 missense probably damaging 0.97
R4769:Trim45 UTSW 3 100931734 intron probably benign
R4840:Trim45 UTSW 3 100925488 missense possibly damaging 0.95
R5030:Trim45 UTSW 3 100928072 missense probably damaging 1.00
R5272:Trim45 UTSW 3 100929919 missense probably damaging 1.00
R5298:Trim45 UTSW 3 100925471 missense probably damaging 1.00
R5498:Trim45 UTSW 3 100925141 missense possibly damaging 0.67
R5589:Trim45 UTSW 3 100929941 missense probably damaging 1.00
R6537:Trim45 UTSW 3 100925396 missense probably benign 0.39
R6850:Trim45 UTSW 3 100923225 nonsense probably null
R7009:Trim45 UTSW 3 100931879 intron probably benign
R7122:Trim45 UTSW 3 100932037 missense unknown
R7583:Trim45 UTSW 3 100925023 missense probably damaging 1.00
X0066:Trim45 UTSW 3 100931767 intron probably benign
Z1088:Trim45 UTSW 3 100925640 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- TCTGAGGCTTTTCAAAGTCCCC -3'
(R):5'- TCTTTACCTATGAGCCTGGCAG -3'

Sequencing Primer
(F):5'- AAAGTCCCCAGGCTCTTGC -3'
(R):5'- GGCTTTGCAGGTCTGACAC -3'
Posted On2015-07-06