Incidental Mutation 'R4368:Psph'
ID325847
Institutional Source Beutler Lab
Gene Symbol Psph
Ensembl Gene ENSMUSG00000029446
Gene Namephosphoserine phosphatase
SynonymsPSPase
MMRRC Submission 041115-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4368 (G1)
Quality Score198
Status Validated
Chromosome5
Chromosomal Location129765558-129787449 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 129771590 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Threonine at position 9 (K9T)
Ref Sequence ENSEMBL: ENSMUSP00000113671 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031399] [ENSMUST00000118268] [ENSMUST00000136507] [ENSMUST00000201394]
Predicted Effect probably benign
Transcript: ENSMUST00000031399
AA Change: K9T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000031399
Gene: ENSMUSG00000029446
AA Change: K9T

DomainStartEndE-ValueType
Pfam:Hydrolase 14 191 5.7e-19 PFAM
Pfam:HAD 17 187 4e-13 PFAM
Pfam:UMPH-1 62 192 5.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000118268
AA Change: K9T

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000113671
Gene: ENSMUSG00000029446
AA Change: K9T

DomainStartEndE-ValueType
PDB:1L8O|B 1 94 1e-55 PDB
SCOP:d1j97a_ 15 92 2e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136280
Predicted Effect probably benign
Transcript: ENSMUST00000136507
AA Change: K9T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000116292
Gene: ENSMUSG00000029446
AA Change: K9T

DomainStartEndE-ValueType
PDB:1NNL|B 1 59 1e-32 PDB
SCOP:d1j97a_ 15 58 2e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201022
Predicted Effect probably benign
Transcript: ENSMUST00000201394
AA Change: K9T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000144667
Gene: ENSMUSG00000029446
AA Change: K9T

DomainStartEndE-ValueType
Pfam:Hydrolase 14 113 4.5e-6 PFAM
Meta Mutation Damage Score 0.1223 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to a subfamily of the phosphotransferases. This encoded enzyme is responsible for the third and last step in L-serine formation. It catalyzes magnesium-dependent hydrolysis of L-phosphoserine and is also involved in an exchange reaction between L-serine and L-phosphoserine. Deficiency of this protein is thought to be linked to Williams syndrome. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449A18Rik A G 3: 59,846,778 noncoding transcript Het
4932438A13Rik C T 3: 36,988,147 Q2761* probably null Het
Adamts7 G A 9: 90,195,851 probably null Het
Adgrv1 A C 13: 81,492,910 S3335R unknown Het
Armc6 G A 8: 70,225,293 L129F probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Cdh19 G A 1: 110,889,712 Q767* probably null Het
Cep120 G A 18: 53,685,885 probably null Het
Dhx38 C T 8: 109,553,131 V976I probably damaging Het
Efr3a T A 15: 65,866,780 F753I possibly damaging Het
Gm5538 T C 3: 59,751,966 F280S probably damaging Het
Hspb7 A T 4: 141,424,018 E157V probably damaging Het
Irx6 A G 8: 92,678,401 E299G probably damaging Het
Jhy T A 9: 40,917,144 N489Y possibly damaging Het
Klhl22 T C 16: 17,789,273 V481A possibly damaging Het
Mapk13 A G 17: 28,777,565 probably null Het
Meis1 A T 11: 19,010,656 probably benign Het
Nlrp14 A G 7: 107,197,805 K301E probably benign Het
Nol10 T C 12: 17,379,292 Y340H probably damaging Het
Olfr267 T C 4: 58,785,153 S190G probably benign Het
Paqr3 T C 5: 97,108,291 S75G probably damaging Het
Pdgfa T C 5: 138,986,306 T113A probably damaging Het
Phactr2 A G 10: 13,253,820 S235P probably damaging Het
Ptpn21 T C 12: 98,678,593 Y1163C probably damaging Het
Scaf8 T C 17: 3,171,195 L319P unknown Het
Slc4a7 C T 14: 14,733,775 R62W probably damaging Het
Slc6a3 C A 13: 73,560,912 C318* probably null Het
Speer3 C G 5: 13,796,380 A238G possibly damaging Het
Taf1c A C 8: 119,599,316 S602R possibly damaging Het
Tiam2 A G 17: 3,414,683 D229G probably benign Het
Tor1a A G 2: 30,967,370 probably benign Het
Trim45 T C 3: 100,923,186 I92T probably damaging Het
Ttll8 G A 15: 88,914,181 P784S possibly damaging Het
Tubg1 G T 11: 101,125,364 probably null Het
Vmn1r178 A T 7: 23,894,022 N92I probably damaging Het
Vmn2r87 A G 10: 130,479,807 V130A probably benign Het
Wdr46 A G 17: 33,941,146 probably benign Het
Yme1l1 A G 2: 23,160,211 H18R possibly damaging Het
Zfp263 T A 16: 3,744,906 probably benign Het
Zfp534 T C 4: 147,675,558 D218G probably benign Het
Zscan12 T C 13: 21,369,383 V459A probably benign Het
Other mutations in Psph
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0121:Psph UTSW 5 129791570 unclassified probably benign
R0539:Psph UTSW 5 129766577 unclassified probably benign
R0650:Psph UTSW 5 129791570 unclassified probably benign
R1236:Psph UTSW 5 129771476 missense probably damaging 1.00
R1474:Psph UTSW 5 129771550 missense probably damaging 1.00
R1844:Psph UTSW 5 129766468 missense probably damaging 1.00
R2130:Psph UTSW 5 129787539 unclassified probably null
R3857:Psph UTSW 5 129771476 missense probably damaging 1.00
R4300:Psph UTSW 5 129787465 unclassified probably null
R4738:Psph UTSW 5 129769386 critical splice acceptor site probably null
R5306:Psph UTSW 5 129769367 missense probably damaging 1.00
R5859:Psph UTSW 5 129790621 unclassified probably benign
R6269:Psph UTSW 5 129766465 missense probably damaging 0.99
R7552:Psph UTSW 5 129770736 missense probably benign 0.01
R7593:Psph UTSW 5 129787273 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- GCCAGAACCTAGGAACTGAGAC -3'
(R):5'- GCATACACCACTGCTTCTGAC -3'

Sequencing Primer
(F):5'- TAACCCAGCCTTTCATCCAGTCAG -3'
(R):5'- ACCACTGCTTCTGACTTAGGTGG -3'
Posted On2015-07-06