Incidental Mutation 'R4368:Vmn1r178'
ID325849
Institutional Source Beutler Lab
Gene Symbol Vmn1r178
Ensembl Gene ENSMUSG00000062598
Gene Namevomeronasal 1 receptor 178
SynonymsV1rd13, LOC232959
MMRRC Submission 041115-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R4368 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location23892009-23895622 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 23894022 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 92 (N92I)
Ref Sequence ENSEMBL: ENSMUSP00000154374 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078593] [ENSMUST00000226450] [ENSMUST00000226489] [ENSMUST00000226640] [ENSMUST00000227993]
Predicted Effect probably damaging
Transcript: ENSMUST00000078593
AA Change: N165I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000077666
Gene: ENSMUSG00000062598
AA Change: N165I

DomainStartEndE-ValueType
Pfam:TAS2R 8 297 7.9e-11 PFAM
Pfam:7tm_1 15 283 2.5e-7 PFAM
Pfam:V1R 41 296 7.8e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000226450
AA Change: N165I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000226489
AA Change: N92I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000226640
AA Change: N92I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000227993
AA Change: N165I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 98% (46/47)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449A18Rik A G 3: 59,846,778 noncoding transcript Het
4932438A13Rik C T 3: 36,988,147 Q2761* probably null Het
Adamts7 G A 9: 90,195,851 probably null Het
Adgrv1 A C 13: 81,492,910 S3335R unknown Het
Armc6 G A 8: 70,225,293 L129F probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Cdh19 G A 1: 110,889,712 Q767* probably null Het
Cep120 G A 18: 53,685,885 probably null Het
Dhx38 C T 8: 109,553,131 V976I probably damaging Het
Efr3a T A 15: 65,866,780 F753I possibly damaging Het
Gm5538 T C 3: 59,751,966 F280S probably damaging Het
Hspb7 A T 4: 141,424,018 E157V probably damaging Het
Irx6 A G 8: 92,678,401 E299G probably damaging Het
Jhy T A 9: 40,917,144 N489Y possibly damaging Het
Klhl22 T C 16: 17,789,273 V481A possibly damaging Het
Mapk13 A G 17: 28,777,565 probably null Het
Meis1 A T 11: 19,010,656 probably benign Het
Nlrp14 A G 7: 107,197,805 K301E probably benign Het
Nol10 T C 12: 17,379,292 Y340H probably damaging Het
Olfr267 T C 4: 58,785,153 S190G probably benign Het
Paqr3 T C 5: 97,108,291 S75G probably damaging Het
Pdgfa T C 5: 138,986,306 T113A probably damaging Het
Phactr2 A G 10: 13,253,820 S235P probably damaging Het
Psph T G 5: 129,771,590 K9T probably benign Het
Ptpn21 T C 12: 98,678,593 Y1163C probably damaging Het
Scaf8 T C 17: 3,171,195 L319P unknown Het
Slc4a7 C T 14: 14,733,775 R62W probably damaging Het
Slc6a3 C A 13: 73,560,912 C318* probably null Het
Speer3 C G 5: 13,796,380 A238G possibly damaging Het
Taf1c A C 8: 119,599,316 S602R possibly damaging Het
Tiam2 A G 17: 3,414,683 D229G probably benign Het
Tor1a A G 2: 30,967,370 probably benign Het
Trim45 T C 3: 100,923,186 I92T probably damaging Het
Ttll8 G A 15: 88,914,181 P784S possibly damaging Het
Tubg1 G T 11: 101,125,364 probably null Het
Vmn2r87 A G 10: 130,479,807 V130A probably benign Het
Wdr46 A G 17: 33,941,146 probably benign Het
Yme1l1 A G 2: 23,160,211 H18R possibly damaging Het
Zfp263 T A 16: 3,744,906 probably benign Het
Zfp534 T C 4: 147,675,558 D218G probably benign Het
Zscan12 T C 13: 21,369,383 V459A probably benign Het
Other mutations in Vmn1r178
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01697:Vmn1r178 APN 7 23893689 missense probably damaging 0.99
IGL01781:Vmn1r178 APN 7 23894009 missense probably damaging 1.00
IGL01934:Vmn1r178 APN 7 23893937 missense probably damaging 1.00
IGL02571:Vmn1r178 APN 7 23894235 missense probably damaging 0.99
IGL02727:Vmn1r178 APN 7 23894446 splice site probably null
IGL03112:Vmn1r178 APN 7 23893661 missense probably damaging 1.00
R0112:Vmn1r178 UTSW 7 23894184 missense possibly damaging 0.93
R0830:Vmn1r178 UTSW 7 23894027 missense possibly damaging 0.91
R1186:Vmn1r178 UTSW 7 23893892 nonsense probably null
R1340:Vmn1r178 UTSW 7 23893856 missense probably benign 0.34
R1640:Vmn1r178 UTSW 7 23894123 missense possibly damaging 0.70
R1696:Vmn1r178 UTSW 7 23894200 missense probably damaging 0.99
R1746:Vmn1r178 UTSW 7 23893904 missense probably benign 0.00
R3084:Vmn1r178 UTSW 7 23893906 missense possibly damaging 0.94
R5199:Vmn1r178 UTSW 7 23894389 missense probably benign 0.11
R6380:Vmn1r178 UTSW 7 23893559 missense possibly damaging 0.62
R7000:Vmn1r178 UTSW 7 23894337 missense probably benign 0.21
R7142:Vmn1r178 UTSW 7 23893610 missense probably damaging 1.00
R7268:Vmn1r178 UTSW 7 23893953 missense probably benign 0.05
R8829:Vmn1r178 UTSW 7 23893839 missense probably damaging 1.00
R8832:Vmn1r178 UTSW 7 23893839 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATACTTTAGTCGCCTGGTGG -3'
(R):5'- GCATCCTGATTGGGAGTGAG -3'

Sequencing Primer
(F):5'- ACAAACATGTGTTCCACCTGTG -3'
(R):5'- AGGATGTGCTGCATTCGC -3'
Posted On2015-07-06