Incidental Mutation 'R4368:Irx6'
ID 325853
Institutional Source Beutler Lab
Gene Symbol Irx6
Ensembl Gene ENSMUSG00000031738
Gene Name Iroquois homeobox 6
Synonyms
MMRRC Submission 041115-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.106) question?
Stock # R4368 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 92674288-92680956 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 92678401 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 299 (E299G)
Ref Sequence ENSEMBL: ENSMUSP00000127446 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034185] [ENSMUST00000167261]
AlphaFold Q9ER75
Predicted Effect possibly damaging
Transcript: ENSMUST00000034185
AA Change: E299G

PolyPhen 2 Score 0.871 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000034185
Gene: ENSMUSG00000031738
AA Change: E299G

DomainStartEndE-ValueType
low complexity region 19 24 N/A INTRINSIC
low complexity region 38 46 N/A INTRINSIC
HOX 143 208 1.76e-13 SMART
coiled coil region 247 280 N/A INTRINSIC
IRO 338 355 9e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167261
AA Change: E299G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000127446
Gene: ENSMUSG00000031738
AA Change: E299G

DomainStartEndE-ValueType
low complexity region 19 24 N/A INTRINSIC
low complexity region 38 46 N/A INTRINSIC
HOX 143 208 1.76e-13 SMART
coiled coil region 247 280 N/A INTRINSIC
IRO 338 355 9e-4 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210252
Meta Mutation Damage Score 0.2554 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 98% (46/47)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display abnormalities in retinal bipolar cell subtype identity and reduced electroretinography a and b wave amplitudes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449A18Rik A G 3: 59,846,778 noncoding transcript Het
4932438A13Rik C T 3: 36,988,147 Q2761* probably null Het
Adamts7 G A 9: 90,195,851 probably null Het
Adgrv1 A C 13: 81,492,910 S3335R unknown Het
Armc6 G A 8: 70,225,293 L129F probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Cdh19 G A 1: 110,889,712 Q767* probably null Het
Cep120 G A 18: 53,685,885 probably null Het
Dhx38 C T 8: 109,553,131 V976I probably damaging Het
Efr3a T A 15: 65,866,780 F753I possibly damaging Het
Gm5538 T C 3: 59,751,966 F280S probably damaging Het
Hspb7 A T 4: 141,424,018 E157V probably damaging Het
Jhy T A 9: 40,917,144 N489Y possibly damaging Het
Klhl22 T C 16: 17,789,273 V481A possibly damaging Het
Mapk13 A G 17: 28,777,565 probably null Het
Meis1 A T 11: 19,010,656 probably benign Het
Nlrp14 A G 7: 107,197,805 K301E probably benign Het
Nol10 T C 12: 17,379,292 Y340H probably damaging Het
Olfr267 T C 4: 58,785,153 S190G probably benign Het
Paqr3 T C 5: 97,108,291 S75G probably damaging Het
Pdgfa T C 5: 138,986,306 T113A probably damaging Het
Phactr2 A G 10: 13,253,820 S235P probably damaging Het
Psph T G 5: 129,771,590 K9T probably benign Het
Ptpn21 T C 12: 98,678,593 Y1163C probably damaging Het
Scaf8 T C 17: 3,171,195 L319P unknown Het
Slc4a7 C T 14: 14,733,775 R62W probably damaging Het
Slc6a3 C A 13: 73,560,912 C318* probably null Het
Speer3 C G 5: 13,796,380 A238G possibly damaging Het
Taf1c A C 8: 119,599,316 S602R possibly damaging Het
Tiam2 A G 17: 3,414,683 D229G probably benign Het
Tor1a A G 2: 30,967,370 probably benign Het
Trim45 T C 3: 100,923,186 I92T probably damaging Het
Ttll8 G A 15: 88,914,181 P784S possibly damaging Het
Tubg1 G T 11: 101,125,364 probably null Het
Vmn1r178 A T 7: 23,894,022 N92I probably damaging Het
Vmn2r87 A G 10: 130,479,807 V130A probably benign Het
Wdr46 A G 17: 33,941,146 probably benign Het
Yme1l1 A G 2: 23,160,211 H18R possibly damaging Het
Zfp263 T A 16: 3,744,906 probably benign Het
Zfp534 T C 4: 147,675,558 D218G probably benign Het
Zscan12 T C 13: 21,369,383 V459A probably benign Het
Other mutations in Irx6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01976:Irx6 APN 8 92676089 nonsense probably null
IGL02308:Irx6 APN 8 92677031 missense probably damaging 1.00
R0308:Irx6 UTSW 8 92677031 missense probably damaging 1.00
R1191:Irx6 UTSW 8 92676952 missense probably damaging 1.00
R1251:Irx6 UTSW 8 92678253 missense possibly damaging 0.87
R4161:Irx6 UTSW 8 92676291 missense possibly damaging 0.78
R4924:Irx6 UTSW 8 92678353 missense probably benign 0.25
R4950:Irx6 UTSW 8 92678800 missense probably damaging 1.00
R5425:Irx6 UTSW 8 92677517 critical splice donor site probably null
R6455:Irx6 UTSW 8 92676072 missense probably benign 0.04
R6969:Irx6 UTSW 8 92677330 missense probably damaging 1.00
R7019:Irx6 UTSW 8 92678734 missense probably damaging 0.99
R7128:Irx6 UTSW 8 92677366 missense probably damaging 1.00
R7133:Irx6 UTSW 8 92678413 missense probably damaging 1.00
R8182:Irx6 UTSW 8 92677014 nonsense probably null
R8546:Irx6 UTSW 8 92678636 missense probably benign 0.19
R8955:Irx6 UTSW 8 92678412 missense probably damaging 1.00
Z1176:Irx6 UTSW 8 92678371 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- GGTTTCCTACAGATGCTACTGCC -3'
(R):5'- ACTCTGGACTTTGTGCCCTG -3'

Sequencing Primer
(F):5'- AGATGCTACTGCCAGCCAGG -3'
(R):5'- TTGAGGGAGCACTTTCGACAG -3'
Posted On 2015-07-06