Incidental Mutation 'R4368:Nol10'
ID325862
Institutional Source Beutler Lab
Gene Symbol Nol10
Ensembl Gene ENSMUSG00000061458
Gene Namenucleolar protein 10
SynonymsLOC217431
MMRRC Submission 041115-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R4368 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location17348458-17430095 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 17379292 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 340 (Y340H)
Ref Sequence ENSEMBL: ENSMUSP00000035930 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046011]
Predicted Effect probably damaging
Transcript: ENSMUST00000046011
AA Change: Y340H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000035930
Gene: ENSMUSG00000061458
AA Change: Y340H

DomainStartEndE-ValueType
WD40 42 81 1.1e1 SMART
Blast:WD40 84 123 1e-8 BLAST
WD40 165 204 3.3e1 SMART
WD40 223 257 4.42e1 SMART
WD40 260 299 1.19e1 SMART
WD40 302 340 1.97e2 SMART
low complexity region 451 476 N/A INTRINSIC
Pfam:NUC153 482 509 1.4e-15 PFAM
low complexity region 515 536 N/A INTRINSIC
low complexity region 542 553 N/A INTRINSIC
coiled coil region 557 588 N/A INTRINSIC
low complexity region 650 660 N/A INTRINSIC
Meta Mutation Damage Score 0.6690 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 98% (46/47)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449A18Rik A G 3: 59,846,778 noncoding transcript Het
4932438A13Rik C T 3: 36,988,147 Q2761* probably null Het
Adamts7 G A 9: 90,195,851 probably null Het
Adgrv1 A C 13: 81,492,910 S3335R unknown Het
Armc6 G A 8: 70,225,293 L129F probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Cdh19 G A 1: 110,889,712 Q767* probably null Het
Cep120 G A 18: 53,685,885 probably null Het
Dhx38 C T 8: 109,553,131 V976I probably damaging Het
Efr3a T A 15: 65,866,780 F753I possibly damaging Het
Gm5538 T C 3: 59,751,966 F280S probably damaging Het
Hspb7 A T 4: 141,424,018 E157V probably damaging Het
Irx6 A G 8: 92,678,401 E299G probably damaging Het
Jhy T A 9: 40,917,144 N489Y possibly damaging Het
Klhl22 T C 16: 17,789,273 V481A possibly damaging Het
Mapk13 A G 17: 28,777,565 probably null Het
Meis1 A T 11: 19,010,656 probably benign Het
Nlrp14 A G 7: 107,197,805 K301E probably benign Het
Olfr267 T C 4: 58,785,153 S190G probably benign Het
Paqr3 T C 5: 97,108,291 S75G probably damaging Het
Pdgfa T C 5: 138,986,306 T113A probably damaging Het
Phactr2 A G 10: 13,253,820 S235P probably damaging Het
Psph T G 5: 129,771,590 K9T probably benign Het
Ptpn21 T C 12: 98,678,593 Y1163C probably damaging Het
Scaf8 T C 17: 3,171,195 L319P unknown Het
Slc4a7 C T 14: 14,733,775 R62W probably damaging Het
Slc6a3 C A 13: 73,560,912 C318* probably null Het
Speer3 C G 5: 13,796,380 A238G possibly damaging Het
Taf1c A C 8: 119,599,316 S602R possibly damaging Het
Tiam2 A G 17: 3,414,683 D229G probably benign Het
Tor1a A G 2: 30,967,370 probably benign Het
Trim45 T C 3: 100,923,186 I92T probably damaging Het
Ttll8 G A 15: 88,914,181 P784S possibly damaging Het
Tubg1 G T 11: 101,125,364 probably null Het
Vmn1r178 A T 7: 23,894,022 N92I probably damaging Het
Vmn2r87 A G 10: 130,479,807 V130A probably benign Het
Wdr46 A G 17: 33,941,146 probably benign Het
Yme1l1 A G 2: 23,160,211 H18R possibly damaging Het
Zfp263 T A 16: 3,744,906 probably benign Het
Zfp534 T C 4: 147,675,558 D218G probably benign Het
Zscan12 T C 13: 21,369,383 V459A probably benign Het
Other mutations in Nol10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00916:Nol10 APN 12 17361129 splice site probably benign
R1769:Nol10 UTSW 12 17416708 splice site probably benign
R1884:Nol10 UTSW 12 17368389 critical splice donor site probably null
R1930:Nol10 UTSW 12 17348554 start codon destroyed probably null 0.99
R1931:Nol10 UTSW 12 17348554 start codon destroyed probably null 0.99
R2010:Nol10 UTSW 12 17416101 missense probably benign 0.00
R2037:Nol10 UTSW 12 17361151 missense probably benign 0.01
R2168:Nol10 UTSW 12 17373584 missense probably damaging 1.00
R3729:Nol10 UTSW 12 17424673 missense probably benign 0.42
R3731:Nol10 UTSW 12 17424673 missense probably benign 0.42
R4618:Nol10 UTSW 12 17348561 missense probably damaging 0.98
R4736:Nol10 UTSW 12 17355287 missense probably damaging 1.00
R5342:Nol10 UTSW 12 17369620 splice site probably null
R5451:Nol10 UTSW 12 17359102 nonsense probably null
R5536:Nol10 UTSW 12 17416137 nonsense probably null
R5586:Nol10 UTSW 12 17416828 missense possibly damaging 0.73
R6045:Nol10 UTSW 12 17348478 start gained probably benign
R6833:Nol10 UTSW 12 17352727 missense probably benign 0.03
R7039:Nol10 UTSW 12 17429184 missense possibly damaging 0.94
R7189:Nol10 UTSW 12 17373561 critical splice acceptor site probably null
R7251:Nol10 UTSW 12 17402107 missense probably damaging 1.00
R7399:Nol10 UTSW 12 17402173 missense probably damaging 1.00
R7600:Nol10 UTSW 12 17369480 missense probably damaging 0.99
R7650:Nol10 UTSW 12 17362682 critical splice donor site probably null
R7729:Nol10 UTSW 12 17424675 missense possibly damaging 0.62
R7772:Nol10 UTSW 12 17348585 missense probably damaging 1.00
R7869:Nol10 UTSW 12 17358238 missense probably null 0.93
R7972:Nol10 UTSW 12 17352647 missense probably benign 0.15
Z1177:Nol10 UTSW 12 17359088 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TATAGAGCTGAGTGCCTCTCCG -3'
(R):5'- TGCTAAACAGCACAAACATTTGGC -3'

Sequencing Primer
(F):5'- ATCAAGCCTGGGTAGTTCAC -3'
(R):5'- CATTTGGCCAACATAATACTGAGAC -3'
Posted On2015-07-06