Incidental Mutation 'R4368:Slc6a3'
ID325865
Institutional Source Beutler Lab
Gene Symbol Slc6a3
Ensembl Gene ENSMUSG00000021609
Gene Namesolute carrier family 6 (neurotransmitter transporter, dopamine), member 3
SynonymsDat1, DAT
MMRRC Submission 041115-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4368 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location73536747-73578672 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 73560912 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 318 (C318*)
Ref Sequence ENSEMBL: ENSMUSP00000022100 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022100]
Predicted Effect probably null
Transcript: ENSMUST00000022100
AA Change: C318*
SMART Domains Protein: ENSMUSP00000022100
Gene: ENSMUSG00000021609
AA Change: C318*

DomainStartEndE-ValueType
Pfam:SNF 60 582 8.1e-237 PFAM
Meta Mutation Damage Score 0.9717 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a dopamine transporter which is a member of the sodium- and chloride-dependent neurotransmitter transporter family. The 3' UTR of this gene contains a 40 bp tandem repeat, referred to as a variable number tandem repeat or VNTR, which can be present in 3 to 11 copies. Variation in the number of repeats is associated with idiopathic epilepsy, attention-deficit hyperactivity disorder, dependence on alcohol and cocaine, susceptibility to Parkinson disease and protection against nicotine dependence.[provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit dwarfism, hyperactivity (especially in a novel environment), 5-fold higher extracellular dopamine levels, impaired spatial cognitive function, anterior pituitary hypoplasia, and failure to lactate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449A18Rik A G 3: 59,846,778 noncoding transcript Het
4932438A13Rik C T 3: 36,988,147 Q2761* probably null Het
Adamts7 G A 9: 90,195,851 probably null Het
Adgrv1 A C 13: 81,492,910 S3335R unknown Het
Armc6 G A 8: 70,225,293 L129F probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Cdh19 G A 1: 110,889,712 Q767* probably null Het
Cep120 G A 18: 53,685,885 probably null Het
Dhx38 C T 8: 109,553,131 V976I probably damaging Het
Efr3a T A 15: 65,866,780 F753I possibly damaging Het
Gm5538 T C 3: 59,751,966 F280S probably damaging Het
Hspb7 A T 4: 141,424,018 E157V probably damaging Het
Irx6 A G 8: 92,678,401 E299G probably damaging Het
Jhy T A 9: 40,917,144 N489Y possibly damaging Het
Klhl22 T C 16: 17,789,273 V481A possibly damaging Het
Mapk13 A G 17: 28,777,565 probably null Het
Meis1 A T 11: 19,010,656 probably benign Het
Nlrp14 A G 7: 107,197,805 K301E probably benign Het
Nol10 T C 12: 17,379,292 Y340H probably damaging Het
Olfr267 T C 4: 58,785,153 S190G probably benign Het
Paqr3 T C 5: 97,108,291 S75G probably damaging Het
Pdgfa T C 5: 138,986,306 T113A probably damaging Het
Phactr2 A G 10: 13,253,820 S235P probably damaging Het
Psph T G 5: 129,771,590 K9T probably benign Het
Ptpn21 T C 12: 98,678,593 Y1163C probably damaging Het
Scaf8 T C 17: 3,171,195 L319P unknown Het
Slc4a7 C T 14: 14,733,775 R62W probably damaging Het
Speer3 C G 5: 13,796,380 A238G possibly damaging Het
Taf1c A C 8: 119,599,316 S602R possibly damaging Het
Tiam2 A G 17: 3,414,683 D229G probably benign Het
Tor1a A G 2: 30,967,370 probably benign Het
Trim45 T C 3: 100,923,186 I92T probably damaging Het
Ttll8 G A 15: 88,914,181 P784S possibly damaging Het
Tubg1 G T 11: 101,125,364 probably null Het
Vmn1r178 A T 7: 23,894,022 N92I probably damaging Het
Vmn2r87 A G 10: 130,479,807 V130A probably benign Het
Wdr46 A G 17: 33,941,146 probably benign Het
Yme1l1 A G 2: 23,160,211 H18R possibly damaging Het
Zfp263 T A 16: 3,744,906 probably benign Het
Zfp534 T C 4: 147,675,558 D218G probably benign Het
Zscan12 T C 13: 21,369,383 V459A probably benign Het
Other mutations in Slc6a3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00773:Slc6a3 APN 13 73544741 missense probably damaging 1.00
IGL01524:Slc6a3 APN 13 73538549 missense probably benign 0.01
IGL02015:Slc6a3 APN 13 73544714 missense possibly damaging 0.60
IGL03008:Slc6a3 APN 13 73558285 critical splice donor site probably null
IGL03029:Slc6a3 APN 13 73538697 missense probably damaging 1.00
IGL03064:Slc6a3 APN 13 73571466 missense probably damaging 0.99
IGL03272:Slc6a3 APN 13 73540929 missense probably damaging 0.98
IGL03294:Slc6a3 APN 13 73557181 critical splice donor site probably null
IGL03345:Slc6a3 APN 13 73571514 missense probably benign
IGL03410:Slc6a3 APN 13 73538657 missense probably benign 0.03
disney UTSW 13 73544884 missense probably benign
dopey UTSW 13 73560959 missense probably damaging 1.00
Dopey2 UTSW 13 73544817 missense probably damaging 1.00
Stiff UTSW 13 73557050 missense possibly damaging 0.85
PIT4382001:Slc6a3 UTSW 13 73571523 missense probably benign 0.35
R0024:Slc6a3 UTSW 13 73540837 splice site probably benign
R0125:Slc6a3 UTSW 13 73569979 splice site probably benign
R0180:Slc6a3 UTSW 13 73562336 missense probably damaging 1.00
R0288:Slc6a3 UTSW 13 73560928 missense probably damaging 1.00
R0322:Slc6a3 UTSW 13 73560926 missense possibly damaging 0.61
R0349:Slc6a3 UTSW 13 73567557 missense probably damaging 1.00
R0411:Slc6a3 UTSW 13 73557050 missense possibly damaging 0.85
R0594:Slc6a3 UTSW 13 73538642 missense probably damaging 0.99
R0680:Slc6a3 UTSW 13 73538727 missense probably damaging 1.00
R1099:Slc6a3 UTSW 13 73567641 missense probably benign 0.21
R1109:Slc6a3 UTSW 13 73557080 missense probably benign 0.00
R1791:Slc6a3 UTSW 13 73566292 missense possibly damaging 0.82
R3916:Slc6a3 UTSW 13 73562308 missense probably benign 0.00
R4279:Slc6a3 UTSW 13 73544834 missense possibly damaging 0.90
R4520:Slc6a3 UTSW 13 73540856 missense possibly damaging 0.95
R4666:Slc6a3 UTSW 13 73538581 missense possibly damaging 0.47
R4675:Slc6a3 UTSW 13 73544817 missense probably damaging 1.00
R4716:Slc6a3 UTSW 13 73557076 missense probably benign 0.04
R5243:Slc6a3 UTSW 13 73571451 missense possibly damaging 0.61
R5355:Slc6a3 UTSW 13 73560959 missense probably damaging 1.00
R5681:Slc6a3 UTSW 13 73538735 missense probably damaging 0.99
R5737:Slc6a3 UTSW 13 73544804 missense probably damaging 0.99
R6142:Slc6a3 UTSW 13 73544783 missense probably benign 0.00
R6471:Slc6a3 UTSW 13 73544884 missense probably benign
R7168:Slc6a3 UTSW 13 73571472 missense probably benign 0.00
R7403:Slc6a3 UTSW 13 73562427 critical splice donor site probably null
R8282:Slc6a3 UTSW 13 73557081 missense probably benign 0.01
R8359:Slc6a3 UTSW 13 73544883 missense probably benign
Predicted Primers PCR Primer
(F):5'- AGTACCTACTGCCACCAAGCTG -3'
(R):5'- GCTCAGAGGCCTCATGATTTTC -3'

Sequencing Primer
(F):5'- AGCTGAGAACTTTTGCAGCC -3'
(R):5'- AGAGGCCTCATGATTTTCCTCTGG -3'
Posted On2015-07-06