Incidental Mutation 'R4368:Slc4a7'
ID325867
Institutional Source Beutler Lab
Gene Symbol Slc4a7
Ensembl Gene ENSMUSG00000021733
Gene Namesolute carrier family 4, sodium bicarbonate cotransporter, member 7
SynonymsNBC3, NBCn1, E430014N10Rik
MMRRC Submission 041115-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.917) question?
Stock #R4368 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location14702279-14799940 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 14733775 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 62 (R62W)
Ref Sequence ENSEMBL: ENSMUSP00000153323 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057015] [ENSMUST00000223607] [ENSMUST00000223695] [ENSMUST00000223740] [ENSMUST00000223761] [ENSMUST00000223981] [ENSMUST00000224049] [ENSMUST00000224222] [ENSMUST00000224333] [ENSMUST00000224672] [ENSMUST00000224752] [ENSMUST00000225175] [ENSMUST00000225232] [ENSMUST00000225238] [ENSMUST00000225630] [ENSMUST00000225979] [ENSMUST00000226079]
Predicted Effect probably damaging
Transcript: ENSMUST00000057015
AA Change: R62W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058313
Gene: ENSMUSG00000021733
AA Change: R62W

DomainStartEndE-ValueType
low complexity region 57 89 N/A INTRINSIC
Pfam:Band_3_cyto 146 413 1.4e-110 PFAM
Pfam:HCO3_cotransp 456 969 1.6e-242 PFAM
transmembrane domain 977 999 N/A INTRINSIC
coiled coil region 1021 1050 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000223607
AA Change: R62W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000223695
AA Change: R68W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000223740
AA Change: R68W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000223761
AA Change: R62W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000223981
AA Change: R62W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000224049
AA Change: R68W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224197
Predicted Effect probably damaging
Transcript: ENSMUST00000224222
AA Change: R62W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000224333
AA Change: R68W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000224672
AA Change: R68W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000224752
AA Change: R67W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000224952
AA Change: R81W

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect probably damaging
Transcript: ENSMUST00000225175
AA Change: R62W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000225232
AA Change: R62W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000225238
AA Change: R62W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225496
Predicted Effect probably damaging
Transcript: ENSMUST00000225630
AA Change: R62W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000225979
AA Change: R62W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000226079
AA Change: R62W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.2779 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This locus encodes a sodium bicarbonate cotransporter. The encoded transmembrane protein appears to transport sodium and bicarbonate ions in a 1:1 ratio, and is thus considered an electroneutral cotransporter. The encoded protein likely plays a critical role in regulation of intracellular pH involved in visual and auditory sensory transmission. Alternatively spliced transcript variants encoding distinct isoforms have been described. [provided by RefSeq, Apr 2012]
PHENOTYPE: Mice homozygous for a disruption at this locus display defects of the auditory and visual systems similar to those observed in patients with Ushers syndrome. Mice homozygous for a gene trap allele exhibit disruption in sodium/bicarbonate function that impacts vasodilation and hypertension. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449A18Rik A G 3: 59,846,778 noncoding transcript Het
4932438A13Rik C T 3: 36,988,147 Q2761* probably null Het
Adamts7 G A 9: 90,195,851 probably null Het
Adgrv1 A C 13: 81,492,910 S3335R unknown Het
Armc6 G A 8: 70,225,293 L129F probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Cdh19 G A 1: 110,889,712 Q767* probably null Het
Cep120 G A 18: 53,685,885 probably null Het
Dhx38 C T 8: 109,553,131 V976I probably damaging Het
Efr3a T A 15: 65,866,780 F753I possibly damaging Het
Gm5538 T C 3: 59,751,966 F280S probably damaging Het
Hspb7 A T 4: 141,424,018 E157V probably damaging Het
Irx6 A G 8: 92,678,401 E299G probably damaging Het
Jhy T A 9: 40,917,144 N489Y possibly damaging Het
Klhl22 T C 16: 17,789,273 V481A possibly damaging Het
Mapk13 A G 17: 28,777,565 probably null Het
Meis1 A T 11: 19,010,656 probably benign Het
Nlrp14 A G 7: 107,197,805 K301E probably benign Het
Nol10 T C 12: 17,379,292 Y340H probably damaging Het
Olfr267 T C 4: 58,785,153 S190G probably benign Het
Paqr3 T C 5: 97,108,291 S75G probably damaging Het
Pdgfa T C 5: 138,986,306 T113A probably damaging Het
Phactr2 A G 10: 13,253,820 S235P probably damaging Het
Psph T G 5: 129,771,590 K9T probably benign Het
Ptpn21 T C 12: 98,678,593 Y1163C probably damaging Het
Scaf8 T C 17: 3,171,195 L319P unknown Het
Slc6a3 C A 13: 73,560,912 C318* probably null Het
Speer3 C G 5: 13,796,380 A238G possibly damaging Het
Taf1c A C 8: 119,599,316 S602R possibly damaging Het
Tiam2 A G 17: 3,414,683 D229G probably benign Het
Tor1a A G 2: 30,967,370 probably benign Het
Trim45 T C 3: 100,923,186 I92T probably damaging Het
Ttll8 G A 15: 88,914,181 P784S possibly damaging Het
Tubg1 G T 11: 101,125,364 probably null Het
Vmn1r178 A T 7: 23,894,022 N92I probably damaging Het
Vmn2r87 A G 10: 130,479,807 V130A probably benign Het
Wdr46 A G 17: 33,941,146 probably benign Het
Yme1l1 A G 2: 23,160,211 H18R possibly damaging Het
Zfp263 T A 16: 3,744,906 probably benign Het
Zfp534 T C 4: 147,675,558 D218G probably benign Het
Zscan12 T C 13: 21,369,383 V459A probably benign Het
Other mutations in Slc4a7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00974:Slc4a7 APN 14 14760292 missense probably benign 0.18
IGL01468:Slc4a7 APN 14 14737480 missense probably damaging 1.00
IGL01863:Slc4a7 APN 14 14762430 missense probably damaging 0.97
IGL03122:Slc4a7 APN 14 14782040 splice site probably benign
R0020:Slc4a7 UTSW 14 14796108 missense probably benign
R0403:Slc4a7 UTSW 14 14766808 missense probably benign 0.02
R0410:Slc4a7 UTSW 14 14738299 missense probably damaging 1.00
R0624:Slc4a7 UTSW 14 14794059 critical splice donor site probably null
R0631:Slc4a7 UTSW 14 14757382 missense probably damaging 1.00
R1128:Slc4a7 UTSW 14 14733832 missense probably damaging 1.00
R1556:Slc4a7 UTSW 14 14778872 missense probably benign 0.01
R1672:Slc4a7 UTSW 14 14760247 missense possibly damaging 0.91
R1711:Slc4a7 UTSW 14 14765709 missense probably benign 0.45
R1870:Slc4a7 UTSW 14 14737509 critical splice donor site probably null
R1939:Slc4a7 UTSW 14 14748581 missense probably damaging 1.00
R2012:Slc4a7 UTSW 14 14733727 nonsense probably null
R2042:Slc4a7 UTSW 14 14737386 missense probably damaging 1.00
R2064:Slc4a7 UTSW 14 14733773 missense probably damaging 1.00
R2404:Slc4a7 UTSW 14 14733733 missense probably damaging 1.00
R2880:Slc4a7 UTSW 14 14773277 missense probably damaging 1.00
R3729:Slc4a7 UTSW 14 14729276 missense probably damaging 1.00
R4395:Slc4a7 UTSW 14 14765665 missense probably damaging 1.00
R4432:Slc4a7 UTSW 14 14757323 missense probably damaging 1.00
R4592:Slc4a7 UTSW 14 14778850 missense probably damaging 1.00
R4705:Slc4a7 UTSW 14 14733856 missense probably damaging 1.00
R4743:Slc4a7 UTSW 14 14796073 splice site probably null
R4765:Slc4a7 UTSW 14 14762414 missense probably damaging 1.00
R4831:Slc4a7 UTSW 14 14772699 critical splice donor site probably null
R4845:Slc4a7 UTSW 14 14733803 missense probably damaging 1.00
R4880:Slc4a7 UTSW 14 14757342 missense probably damaging 1.00
R4948:Slc4a7 UTSW 14 14771283 missense possibly damaging 0.68
R5348:Slc4a7 UTSW 14 14786310 missense probably benign 0.02
R5385:Slc4a7 UTSW 14 14773345 missense possibly damaging 0.94
R5418:Slc4a7 UTSW 14 14760280 missense probably benign 0.25
R5480:Slc4a7 UTSW 14 14782138 missense probably damaging 1.00
R5842:Slc4a7 UTSW 14 14778866 missense probably damaging 1.00
R5919:Slc4a7 UTSW 14 14791092 missense probably benign
R6063:Slc4a7 UTSW 14 14793964 missense possibly damaging 0.60
R6065:Slc4a7 UTSW 14 14739836 missense probably benign 0.29
R6549:Slc4a7 UTSW 14 14748564 missense probably damaging 1.00
R6845:Slc4a7 UTSW 14 14775000 missense probably damaging 1.00
R6870:Slc4a7 UTSW 14 14733846 missense probably damaging 1.00
R6881:Slc4a7 UTSW 14 14737452 missense probably benign 0.43
R6962:Slc4a7 UTSW 14 14746021 missense probably damaging 0.99
R7099:Slc4a7 UTSW 14 14733750 missense probably damaging 1.00
R7180:Slc4a7 UTSW 14 14765580 missense probably damaging 1.00
R7346:Slc4a7 UTSW 14 14775000 missense probably damaging 1.00
R7378:Slc4a7 UTSW 14 14757421 missense probably damaging 1.00
R7646:Slc4a7 UTSW 14 14773348 missense probably benign 0.01
R7647:Slc4a7 UTSW 14 14773348 missense probably benign 0.01
R7648:Slc4a7 UTSW 14 14773348 missense probably benign 0.01
R7650:Slc4a7 UTSW 14 14773348 missense probably benign 0.01
R7857:Slc4a7 UTSW 14 14772624 missense probably benign 0.00
R7892:Slc4a7 UTSW 14 14773348 missense probably benign 0.01
R7940:Slc4a7 UTSW 14 14772624 missense probably benign 0.00
R7975:Slc4a7 UTSW 14 14773348 missense probably benign 0.01
X0067:Slc4a7 UTSW 14 14771276 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TCGTGACTTTGAGCTCACATG -3'
(R):5'- ACACTCATGCACCAGATTCTG -3'

Sequencing Primer
(F):5'- CGTGACTTTGAGCTCACATGTAATTC -3'
(R):5'- TAGACCCCGCTGTAGAAATGCTTG -3'
Posted On2015-07-06