Incidental Mutation 'R4368:Wdr46'
ID325875
Institutional Source Beutler Lab
Gene Symbol Wdr46
Ensembl Gene ENSMUSG00000024312
Gene NameWD repeat domain 46
SynonymsBing4, 2310007I04Rik
MMRRC Submission 041115-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.969) question?
Stock #R4368 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location33940660-33949695 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 33941146 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000137072 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025163] [ENSMUST00000025170] [ENSMUST00000047503] [ENSMUST00000173363] [ENSMUST00000174048] [ENSMUST00000174426] [ENSMUST00000179418]
Predicted Effect probably benign
Transcript: ENSMUST00000025163
SMART Domains Protein: ENSMUSP00000025163
Gene: ENSMUSG00000024309

DomainStartEndE-ValueType
Pfam:Prefoldin_2 10 115 9.6e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000025170
SMART Domains Protein: ENSMUSP00000025170
Gene: ENSMUSG00000024312

DomainStartEndE-ValueType
coiled coil region 126 155 N/A INTRINSIC
low complexity region 204 217 N/A INTRINSIC
WD40 225 262 1.02e2 SMART
WD40 267 302 3.3e1 SMART
Blast:WD40 305 344 8e-19 BLAST
WD40 347 386 9.52e-6 SMART
Blast:WD40 392 426 3e-14 BLAST
BING4CT 439 517 8.85e-53 SMART
low complexity region 542 556 N/A INTRINSIC
low complexity region 586 593 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000047503
SMART Domains Protein: ENSMUSP00000041082
Gene: ENSMUSG00000041354

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
low complexity region 31 42 N/A INTRINSIC
low complexity region 44 63 N/A INTRINSIC
RasGEFN 87 212 9.54e-30 SMART
RasGEF 239 514 7.15e-106 SMART
low complexity region 578 592 N/A INTRINSIC
low complexity region 602 619 N/A INTRINSIC
low complexity region 633 648 N/A INTRINSIC
RA 649 736 2.05e-19 SMART
low complexity region 737 762 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172546
Predicted Effect probably benign
Transcript: ENSMUST00000173284
SMART Domains Protein: ENSMUSP00000134312
Gene: ENSMUSG00000041354

DomainStartEndE-ValueType
Blast:RasGEF 2 67 1e-35 BLAST
PDB:4JGW|B 2 67 1e-35 PDB
SCOP:d1bkds_ 2 94 3e-16 SMART
low complexity region 131 145 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 186 201 N/A INTRINSIC
RA 202 289 2.05e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173363
SMART Domains Protein: ENSMUSP00000138662
Gene: ENSMUSG00000024309

DomainStartEndE-ValueType
Pfam:Prefoldin_2 1 89 1.1e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173678
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173857
Predicted Effect probably benign
Transcript: ENSMUST00000174048
SMART Domains Protein: ENSMUSP00000133656
Gene: ENSMUSG00000024309

DomainStartEndE-ValueType
Pfam:Prefoldin_2 10 115 2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174426
SMART Domains Protein: ENSMUSP00000134069
Gene: ENSMUSG00000024309

DomainStartEndE-ValueType
Pfam:Prefoldin_2 1 89 1.1e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174442
Predicted Effect probably benign
Transcript: ENSMUST00000179418
SMART Domains Protein: ENSMUSP00000137072
Gene: ENSMUSG00000024309

DomainStartEndE-ValueType
Pfam:Prefoldin_2 10 115 2e-28 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 98% (46/47)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449A18Rik A G 3: 59,846,778 noncoding transcript Het
4932438A13Rik C T 3: 36,988,147 Q2761* probably null Het
Adamts7 G A 9: 90,195,851 probably null Het
Adgrv1 A C 13: 81,492,910 S3335R unknown Het
Armc6 G A 8: 70,225,293 L129F probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Cdh19 G A 1: 110,889,712 Q767* probably null Het
Cep120 G A 18: 53,685,885 probably null Het
Dhx38 C T 8: 109,553,131 V976I probably damaging Het
Efr3a T A 15: 65,866,780 F753I possibly damaging Het
Gm5538 T C 3: 59,751,966 F280S probably damaging Het
Hspb7 A T 4: 141,424,018 E157V probably damaging Het
Irx6 A G 8: 92,678,401 E299G probably damaging Het
Jhy T A 9: 40,917,144 N489Y possibly damaging Het
Klhl22 T C 16: 17,789,273 V481A possibly damaging Het
Mapk13 A G 17: 28,777,565 probably null Het
Meis1 A T 11: 19,010,656 probably benign Het
Nlrp14 A G 7: 107,197,805 K301E probably benign Het
Nol10 T C 12: 17,379,292 Y340H probably damaging Het
Olfr267 T C 4: 58,785,153 S190G probably benign Het
Paqr3 T C 5: 97,108,291 S75G probably damaging Het
Pdgfa T C 5: 138,986,306 T113A probably damaging Het
Phactr2 A G 10: 13,253,820 S235P probably damaging Het
Psph T G 5: 129,771,590 K9T probably benign Het
Ptpn21 T C 12: 98,678,593 Y1163C probably damaging Het
Scaf8 T C 17: 3,171,195 L319P unknown Het
Slc4a7 C T 14: 14,733,775 R62W probably damaging Het
Slc6a3 C A 13: 73,560,912 C318* probably null Het
Speer3 C G 5: 13,796,380 A238G possibly damaging Het
Taf1c A C 8: 119,599,316 S602R possibly damaging Het
Tiam2 A G 17: 3,414,683 D229G probably benign Het
Tor1a A G 2: 30,967,370 probably benign Het
Trim45 T C 3: 100,923,186 I92T probably damaging Het
Ttll8 G A 15: 88,914,181 P784S possibly damaging Het
Tubg1 G T 11: 101,125,364 probably null Het
Vmn1r178 A T 7: 23,894,022 N92I probably damaging Het
Vmn2r87 A G 10: 130,479,807 V130A probably benign Het
Yme1l1 A G 2: 23,160,211 H18R possibly damaging Het
Zfp263 T A 16: 3,744,906 probably benign Het
Zfp534 T C 4: 147,675,558 D218G probably benign Het
Zscan12 T C 13: 21,369,383 V459A probably benign Het
Other mutations in Wdr46
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0147:Wdr46 UTSW 17 33941023 missense probably benign
R0148:Wdr46 UTSW 17 33941023 missense probably benign
R1405:Wdr46 UTSW 17 33949083 missense probably damaging 1.00
R1405:Wdr46 UTSW 17 33949083 missense probably damaging 1.00
R2085:Wdr46 UTSW 17 33941451 nonsense probably null
R4319:Wdr46 UTSW 17 33940744 missense probably benign 0.04
R4831:Wdr46 UTSW 17 33941836 missense probably benign 0.17
R4831:Wdr46 UTSW 17 33949399 unclassified probably benign
R5118:Wdr46 UTSW 17 33948837 missense possibly damaging 0.65
R6211:Wdr46 UTSW 17 33944485 missense probably damaging 1.00
R6347:Wdr46 UTSW 17 33941852 missense probably damaging 1.00
R6529:Wdr46 UTSW 17 33949146 missense possibly damaging 0.78
R7318:Wdr46 UTSW 17 33941885 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GTGCGAAGGCTTTTCCTCTG -3'
(R):5'- TGTTGACAGGGTTGCAAGAAC -3'

Sequencing Primer
(F):5'- TTAGAAACCGCGGCGCTAC -3'
(R):5'- GGGTCCCAGGAAAACCACTG -3'
Posted On2015-07-06