Incidental Mutation 'R4369:Eps8l3'
ID325883
Institutional Source Beutler Lab
Gene Symbol Eps8l3
Ensembl Gene ENSMUSG00000040600
Gene NameEPS8-like 3
Synonyms
MMRRC Submission 041116-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4369 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location107877229-107892900 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107891014 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 466 (Y466H)
Ref Sequence ENSEMBL: ENSMUSP00000042004 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004134] [ENSMUST00000037375] [ENSMUST00000167387] [ENSMUST00000167523] [ENSMUST00000170058] [ENSMUST00000172247]
Predicted Effect probably benign
Transcript: ENSMUST00000004134
SMART Domains Protein: ENSMUSP00000004134
Gene: ENSMUSG00000004032

DomainStartEndE-ValueType
Pfam:GST_N 6 85 4e-23 PFAM
Pfam:GST_C 107 195 1.5e-19 PFAM
Pfam:GST_C_3 113 193 2.9e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000037375
AA Change: Y466H

PolyPhen 2 Score 0.950 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000042004
Gene: ENSMUSG00000040600
AA Change: Y466H

DomainStartEndE-ValueType
Pfam:PTB 28 155 3.7e-40 PFAM
low complexity region 204 214 N/A INTRINSIC
low complexity region 230 247 N/A INTRINSIC
low complexity region 273 285 N/A INTRINSIC
SH3 460 515 5.19e-15 SMART
PDB:2E8M|A 516 582 3e-7 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131345
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133570
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135512
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137800
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137970
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138472
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144591
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145191
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146337
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152663
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154329
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163675
Predicted Effect probably benign
Transcript: ENSMUST00000167387
SMART Domains Protein: ENSMUSP00000127020
Gene: ENSMUSG00000004032

DomainStartEndE-ValueType
Pfam:GST_C 41 129 2.1e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167523
SMART Domains Protein: ENSMUSP00000127840
Gene: ENSMUSG00000004032

DomainStartEndE-ValueType
Pfam:GST_N 6 67 6.2e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170058
SMART Domains Protein: ENSMUSP00000125913
Gene: ENSMUSG00000004032

DomainStartEndE-ValueType
Pfam:GST_N 6 55 3.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172247
SMART Domains Protein: ENSMUSP00000129426
Gene: ENSMUSG00000004032

DomainStartEndE-ValueType
Pfam:GST_N 6 85 2.1e-21 PFAM
Pfam:GST_C 107 193 2.2e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198085
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is related to epidermal growth factor receptor pathway substrate 8 (EPS8), a substrate for the epidermal growth factor receptor. The function of this protein is unknown. Alternatively spliced transcript variants encoding different isoforms exist. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730596B20Rik A T 6: 52,179,062 probably benign Het
A730018C14Rik T C 12: 112,415,614 noncoding transcript Het
Abcc1 T G 16: 14,460,993 S1056A possibly damaging Het
Akr1c19 A T 13: 4,233,780 K4* probably null Het
Amph T A 13: 19,137,700 S516R probably benign Het
Apoh T C 11: 108,397,379 F108L probably damaging Het
Arg2 T C 12: 79,149,972 S156P probably damaging Het
AU018091 A T 7: 3,157,975 L582* probably null Het
Bckdk C T 7: 127,906,419 A238V probably benign Het
Bean1 T A 8: 104,217,110 V275D probably damaging Het
Brpf3 C T 17: 28,836,620 A1181V probably damaging Het
Cfb T C 17: 34,860,314 K287R probably damaging Het
Cpd T C 11: 76,797,711 N912D possibly damaging Het
Cyp4f14 T C 17: 32,909,258 N261S probably benign Het
Dennd3 T C 15: 73,540,809 I440T probably damaging Het
Dhx38 C T 8: 109,553,131 V976I probably damaging Het
Dpep2 T G 8: 105,985,075 L573F probably benign Het
Ebag9 T C 15: 44,628,469 S86P probably benign Het
Epha1 T C 6: 42,365,457 Y319C probably damaging Het
Ercc6 A G 14: 32,517,207 E84G probably damaging Het
Ffar1 A G 7: 30,860,608 I288T probably benign Het
Flnb C T 14: 7,942,216 T2398I probably benign Het
Galnt15 T C 14: 32,029,539 F16S possibly damaging Het
Golgb1 A G 16: 36,916,907 E2172G probably damaging Het
Lhx4 T A 1: 155,704,814 H161L probably benign Het
Lrp1 T C 10: 127,550,286 N3457S possibly damaging Het
Map7d1 A T 4: 126,235,073 S436T probably damaging Het
Nmral1 T C 16: 4,714,530 Y139C probably damaging Het
Noc2l A G 4: 156,237,396 D84G possibly damaging Het
Olfr447 T A 6: 42,912,277 Y251* probably null Het
Olfr507 C T 7: 108,621,889 L26F probably benign Het
Osbpl11 T C 16: 33,224,648 S386P probably damaging Het
Papss2 A G 19: 32,641,391 H283R probably damaging Het
Pcdha11 T C 18: 37,006,743 V475A possibly damaging Het
Pglyrp3 T C 3: 92,028,079 I212T probably damaging Het
Pkhd1l1 C T 15: 44,505,553 R865W probably benign Het
Prdm9 T C 17: 15,544,446 T691A probably benign Het
Rnf121 T C 7: 102,024,106 D206G probably benign Het
Rnf122 T A 8: 31,112,149 M1K probably null Het
Shank2 T C 7: 144,179,781 S22P probably damaging Het
Smg6 C T 11: 74,932,443 R175* probably null Het
Speer3 C G 5: 13,796,380 A238G possibly damaging Het
Tcrg-V4 T C 13: 19,185,397 Y104H probably benign Het
Thsd7a C T 6: 12,468,908 C557Y probably damaging Het
Tiam2 A G 17: 3,413,967 probably benign Het
Ttn C T 2: 76,764,001 W18788* probably null Het
Vmn2r82 A T 10: 79,396,080 I638F probably benign Het
Zswim6 A G 13: 107,726,694 noncoding transcript Het
Other mutations in Eps8l3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01627:Eps8l3 APN 3 107881171 missense probably damaging 0.97
IGL01694:Eps8l3 APN 3 107892308 missense probably damaging 1.00
IGL02748:Eps8l3 APN 3 107879368 intron probably benign
PIT1430001:Eps8l3 UTSW 3 107884867 missense probably damaging 1.00
R0060:Eps8l3 UTSW 3 107879541 missense probably damaging 0.98
R0060:Eps8l3 UTSW 3 107879541 missense probably damaging 0.98
R0517:Eps8l3 UTSW 3 107883460 missense probably benign
R0555:Eps8l3 UTSW 3 107892345 missense probably benign
R0585:Eps8l3 UTSW 3 107881197 missense probably damaging 0.99
R0646:Eps8l3 UTSW 3 107884810 missense probably damaging 1.00
R0741:Eps8l3 UTSW 3 107882825 missense probably benign
R1682:Eps8l3 UTSW 3 107891306 missense possibly damaging 0.82
R1844:Eps8l3 UTSW 3 107879586 missense possibly damaging 0.95
R1900:Eps8l3 UTSW 3 107890952 missense probably benign 0.16
R1937:Eps8l3 UTSW 3 107884392 missense probably benign 0.02
R2010:Eps8l3 UTSW 3 107879372 start codon destroyed probably null 1.00
R2973:Eps8l3 UTSW 3 107891328 missense probably damaging 1.00
R4803:Eps8l3 UTSW 3 107891009 missense probably damaging 1.00
R4926:Eps8l3 UTSW 3 107890688 splice site probably benign
R5420:Eps8l3 UTSW 3 107883985 nonsense probably null
R5580:Eps8l3 UTSW 3 107881603 missense probably damaging 1.00
R5593:Eps8l3 UTSW 3 107891188 unclassified probably benign
R5699:Eps8l3 UTSW 3 107879579 missense probably benign 0.06
R5705:Eps8l3 UTSW 3 107891264 missense probably benign 0.01
R5972:Eps8l3 UTSW 3 107884447 splice site probably null
R6250:Eps8l3 UTSW 3 107890465 missense probably benign 0.01
R7097:Eps8l3 UTSW 3 107884485 intron probably null
Z1177:Eps8l3 UTSW 3 107881666 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AATCCCAGAGACCATTGGCC -3'
(R):5'- GCTCTGATCCAGAACCTACC -3'

Sequencing Primer
(F):5'- CGGGGGCACAATTCCTATTC -3'
(R):5'- TCTGATCCAGAACCTACCGAGAATC -3'
Posted On2015-07-06