Incidental Mutation 'R0012:Map3k4'
ID32590
Institutional Source Beutler Lab
Gene Symbol Map3k4
Ensembl Gene ENSMUSG00000014426
Gene Namemitogen-activated protein kinase kinase kinase 4
SynonymsD17Rp17, D17Rp17e, RP17, MAPKKK4, Mekk4, MTK1, Tas
MMRRC Submission 038307-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.949) question?
Stock #R0012 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location12227621-12318660 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 12238189 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1289 (S1289P)
Ref Sequence ENSEMBL: ENSMUSP00000086459 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089058]
Predicted Effect probably damaging
Transcript: ENSMUST00000089058
AA Change: S1289P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000086459
Gene: ENSMUSG00000014426
AA Change: S1289P

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
low complexity region 27 43 N/A INTRINSIC
low complexity region 215 235 N/A INTRINSIC
low complexity region 432 462 N/A INTRINSIC
low complexity region 1177 1191 N/A INTRINSIC
S_TKc 1332 1590 1.41e-91 SMART
Meta Mutation Damage Score 0.6470 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.7%
Validation Efficiency 98% (81/83)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The central core of each mitogen-activated protein kinase (MAPK) pathway is a conserved cascade of 3 protein kinases: an activated MAPK kinase kinase (MAPKKK) phosphorylates and activates a specific MAPK kinase (MAPKK), which then activates a specific MAPK. While the ERK MAPKs are activated by mitogenic stimulation, the CSBP2 and JNK MAPKs are activated by environmental stresses such as osmotic shock, UV irradiation, wound stress, and inflammatory factors. This gene encodes a MAPKKK, the MEKK4 protein, also called MTK1. This protein contains a protein kinase catalytic domain at the C terminus. The N-terminal nonkinase domain may contain a regulatory domain. Expression of MEKK4 in mammalian cells activated the CSBP2 and JNK MAPK pathways, but not the ERK pathway. In vitro kinase studies indicated that recombinant MEKK4 can specifically phosphorylate and activate PRKMK6 and SERK1, MAPKKs that activate CSBP2 and JNK, respectively but cannot phosphorylate PRKMK1, an MAPKK that activates ERKs. MEKK4 is a major mediator of environmental stresses that activate the CSBP2 MAPK pathway, and a minor mediator of the JNK pathway. Several alternatively spliced transcripts encoding distinct isoforms have been described. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygous null mice exhibit some perinatal lethality and survivors appear smaller. On certain genetic backgrounds, heterozygous X/Y mice may develop as phenotypic females or hermaphrodites. The sex-reversal phenotype is dependent on a combination of strain-specific autosomal and Y-linked alleles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam33 A T 2: 131,052,920 L687Q probably damaging Het
Adap1 A G 5: 139,307,734 probably benign Het
Add2 T A 6: 86,098,628 V253E probably damaging Het
Agtr1a A T 13: 30,381,749 I266F probably damaging Het
Anxa9 A G 3: 95,308,095 probably benign Het
Arap2 G A 5: 62,683,484 L680F probably damaging Het
Asna1 T C 8: 85,025,096 probably benign Het
Bnip3 A G 7: 138,898,672 probably benign Het
Brwd1 A C 16: 96,059,652 S311R probably damaging Het
C2cd3 G A 7: 100,418,522 V871M possibly damaging Het
Cacul1 A G 19: 60,564,253 W145R probably damaging Het
Celf5 C A 10: 81,469,512 V141L probably damaging Het
Cfap206 C A 4: 34,714,519 L392F possibly damaging Het
Chd2 G T 7: 73,455,519 T192K probably damaging Het
Chrna10 T C 7: 102,115,057 N40S possibly damaging Het
Cic T A 7: 25,287,140 S1299T probably damaging Het
Cic C A 7: 25,287,141 S1299Y probably damaging Het
Clspn T A 4: 126,564,929 probably benign Het
Clstn1 G A 4: 149,634,796 V361M probably damaging Het
Col5a3 A T 9: 20,777,108 probably benign Het
Copb1 T A 7: 114,237,408 K366N probably damaging Het
Cul9 G A 17: 46,538,510 R570C probably benign Het
Cyp2c70 A T 19: 40,187,243 L7Q probably null Het
Dock2 T C 11: 34,783,795 E10G possibly damaging Het
Dpysl4 T G 7: 139,097,883 I412S probably benign Het
Eaf2 T A 16: 36,808,174 probably benign Het
Fasl T C 1: 161,788,164 D41G probably benign Het
Fat2 A G 11: 55,262,871 V3505A probably benign Het
Fbxo24 A G 5: 137,621,994 F101S probably damaging Het
Fdft1 T C 14: 63,177,698 I28M probably benign Het
Gcnt3 T C 9: 70,034,085 I400M probably benign Het
Gpd2 T A 2: 57,338,868 M228K probably damaging Het
Gsap T A 5: 21,226,229 probably benign Het
Hipk1 A G 3: 103,763,680 M467T probably damaging Het
Hmgb4 T A 4: 128,260,725 I17F probably damaging Het
Ints10 C A 8: 68,807,475 L284M probably benign Het
Kif17 T G 4: 138,293,748 S606A probably damaging Het
Lifr C A 15: 7,175,608 T442K possibly damaging Het
Lypd4 A G 7: 24,865,332 L127P probably damaging Het
Lyst A G 13: 13,687,694 H2605R probably benign Het
Mgam T A 6: 40,765,256 probably null Het
Mob1b G A 5: 88,756,084 probably benign Het
Mrgpra1 A G 7: 47,335,470 S154P probably damaging Het
Ms4a4c C A 19: 11,418,980 probably benign Het
Mthfd2l A T 5: 90,961,383 H224L probably damaging Het
Myh8 T C 11: 67,300,021 Y1350H probably benign Het
Nectin2 T C 7: 19,730,744 probably benign Het
Nos1 A C 5: 117,893,902 N305T probably damaging Het
Ogfrl1 T A 1: 23,370,125 Q340L possibly damaging Het
Olfr1318 A T 2: 112,156,826 N292Y possibly damaging Het
Olfr1502 C A 19: 13,861,823 T10K probably damaging Het
Olfr170 T C 16: 19,606,440 N76S probably benign Het
Olfr427 T G 1: 174,100,207 F250V probably damaging Het
Orc1 T C 4: 108,595,646 probably null Het
Plekhg5 C A 4: 152,104,750 D249E probably benign Het
Plet1 A G 9: 50,499,130 I74V probably benign Het
Psmd2 T A 16: 20,661,684 D718E probably damaging Het
Rab33b G T 3: 51,484,316 probably benign Het
Rae1 T A 2: 173,002,673 F4I unknown Het
Ralgapa2 A G 2: 146,412,752 Y821H probably benign Het
Scd2 G A 19: 44,301,246 V227I probably benign Het
Sharpin G T 15: 76,348,343 P156T possibly damaging Het
Slc38a4 C T 15: 96,999,629 R435H probably damaging Het
Snrnp200 T C 2: 127,228,549 V1061A probably benign Het
Suclg1 A G 6: 73,270,997 T234A possibly damaging Het
Swsap1 T C 9: 21,957,022 C197R probably benign Het
Tbx15 A G 3: 99,352,096 T428A probably benign Het
Tet2 T C 3: 133,476,558 Y1215C probably damaging Het
Tjp1 A G 7: 65,329,775 probably benign Het
Tmem209 G T 6: 30,502,113 probably benign Het
Tnpo3 T C 6: 29,589,177 E58G probably damaging Het
Trp53bp2 T A 1: 182,444,718 M464K probably damaging Het
Ttc32 A G 12: 9,035,897 Y148C possibly damaging Het
Unc80 T C 1: 66,507,391 S541P probably damaging Het
Ushbp1 T C 8: 71,395,040 probably benign Het
Vmn2r100 A G 17: 19,504,874 M22V probably benign Het
Vmn2r100 A T 17: 19,526,034 E485V probably damaging Het
Wdr24 G A 17: 25,827,113 V471I probably benign Het
Zfp35 T A 18: 24,002,944 M115K probably benign Het
Zfp429 G A 13: 67,390,677 S216L probably benign Het
Zfp644 T G 5: 106,635,043 E1155A probably benign Het
Other mutations in Map3k4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01065:Map3k4 APN 17 12232990 missense probably damaging 1.00
IGL01124:Map3k4 APN 17 12255200 missense probably benign 0.01
IGL01125:Map3k4 APN 17 12271962 missense probably damaging 0.96
IGL01585:Map3k4 APN 17 12248959 missense probably damaging 1.00
IGL02194:Map3k4 APN 17 12248995 missense probably benign 0.30
IGL02194:Map3k4 APN 17 12263928 missense probably damaging 1.00
IGL02292:Map3k4 APN 17 12235158 missense possibly damaging 0.77
IGL02326:Map3k4 APN 17 12249010 missense probably damaging 1.00
IGL02388:Map3k4 APN 17 12271610 missense probably damaging 0.99
IGL02621:Map3k4 APN 17 12264013 missense probably damaging 1.00
IGL02668:Map3k4 APN 17 12235953 missense possibly damaging 0.85
IGL02850:Map3k4 APN 17 12271914 missense probably damaging 1.00
IGL02939:Map3k4 APN 17 12272149 missense probably damaging 1.00
IGL03148:Map3k4 APN 17 12238158 missense probably benign 0.01
IGL03238:Map3k4 APN 17 12271158 missense probably benign 0.10
ANU74:Map3k4 UTSW 17 12232976 missense probably damaging 1.00
R0012:Map3k4 UTSW 17 12238189 missense probably damaging 1.00
R0128:Map3k4 UTSW 17 12248063 missense probably damaging 0.99
R0183:Map3k4 UTSW 17 12235128 missense probably damaging 1.00
R0309:Map3k4 UTSW 17 12271015 frame shift probably null
R0355:Map3k4 UTSW 17 12254171 missense probably damaging 1.00
R0367:Map3k4 UTSW 17 12258041 splice site probably benign
R1103:Map3k4 UTSW 17 12237063 splice site probably null
R1446:Map3k4 UTSW 17 12256794 nonsense probably null
R1542:Map3k4 UTSW 17 12235906 missense probably damaging 0.97
R1713:Map3k4 UTSW 17 12249571 missense probably benign 0.39
R1777:Map3k4 UTSW 17 12271730 missense possibly damaging 0.82
R1797:Map3k4 UTSW 17 12264019 missense probably benign 0.30
R1997:Map3k4 UTSW 17 12254995 critical splice donor site probably null
R2042:Map3k4 UTSW 17 12277983 missense probably damaging 0.99
R2878:Map3k4 UTSW 17 12264067 missense probably benign 0.00
R2939:Map3k4 UTSW 17 12261270 missense probably damaging 0.98
R2940:Map3k4 UTSW 17 12261270 missense probably damaging 0.98
R3405:Map3k4 UTSW 17 12256781 missense probably damaging 1.00
R3930:Map3k4 UTSW 17 12235993 missense possibly damaging 0.83
R4291:Map3k4 UTSW 17 12255260 missense probably benign 0.08
R4410:Map3k4 UTSW 17 12248998 missense probably damaging 1.00
R4632:Map3k4 UTSW 17 12232504 missense probably damaging 1.00
R4641:Map3k4 UTSW 17 12264045 missense probably damaging 1.00
R4726:Map3k4 UTSW 17 12232964 missense possibly damaging 0.89
R4730:Map3k4 UTSW 17 12248974 missense probably damaging 0.99
R4832:Map3k4 UTSW 17 12271780 missense probably damaging 1.00
R4896:Map3k4 UTSW 17 12272019 missense possibly damaging 0.65
R4934:Map3k4 UTSW 17 12271900 missense probably damaging 1.00
R4971:Map3k4 UTSW 17 12249495 critical splice donor site probably null
R4980:Map3k4 UTSW 17 12272071 missense probably damaging 1.00
R5211:Map3k4 UTSW 17 12232434 missense possibly damaging 0.88
R5337:Map3k4 UTSW 17 12271610 missense probably damaging 0.99
R5356:Map3k4 UTSW 17 12247308 missense possibly damaging 0.87
R5550:Map3k4 UTSW 17 12243558 nonsense probably null
R5824:Map3k4 UTSW 17 12229639 missense probably damaging 1.00
R5890:Map3k4 UTSW 17 12271416 missense probably damaging 1.00
R6285:Map3k4 UTSW 17 12264058 missense probably damaging 1.00
R6380:Map3k4 UTSW 17 12272067 missense possibly damaging 0.56
R6383:Map3k4 UTSW 17 12249583 missense possibly damaging 0.82
R6571:Map3k4 UTSW 17 12242692 missense possibly damaging 0.80
R6584:Map3k4 UTSW 17 12260491 missense probably damaging 1.00
R6616:Map3k4 UTSW 17 12271344 missense probably damaging 1.00
R6644:Map3k4 UTSW 17 12232410 critical splice donor site probably null
R6909:Map3k4 UTSW 17 12270985 missense probably damaging 1.00
R6947:Map3k4 UTSW 17 12260569 nonsense probably null
R6970:Map3k4 UTSW 17 12248916 missense probably damaging 1.00
R7120:Map3k4 UTSW 17 12271467 missense probably damaging 1.00
R7253:Map3k4 UTSW 17 12272068 missense probably benign 0.00
R7267:Map3k4 UTSW 17 12271649 nonsense probably null
R7322:Map3k4 UTSW 17 12270946 missense probably damaging 1.00
R7522:Map3k4 UTSW 17 12261332 missense probably benign 0.39
R7554:Map3k4 UTSW 17 12232413 missense probably damaging 1.00
R7554:Map3k4 UTSW 17 12232414 nonsense probably null
R7681:Map3k4 UTSW 17 12318543 missense unknown
R7734:Map3k4 UTSW 17 12264111 missense probably damaging 1.00
R7842:Map3k4 UTSW 17 12271143 missense possibly damaging 0.54
R7925:Map3k4 UTSW 17 12271143 missense possibly damaging 0.54
R8013:Map3k4 UTSW 17 12271031 nonsense probably null
R8014:Map3k4 UTSW 17 12271031 nonsense probably null
X0067:Map3k4 UTSW 17 12264094 missense probably benign 0.03
Z1177:Map3k4 UTSW 17 12271697 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTCTGGCTCAATGACCCCTTGG -3'
(R):5'- TGACTGTGACTGTGAATGCGGC -3'

Sequencing Primer
(F):5'- AATGACCCCTTGGCATCC -3'
(R):5'- TCAGTGTCCATCAGCAGAGG -3'
Posted On2013-05-09