Incidental Mutation 'R4369:Dhx38'
ID325904
Institutional Source Beutler Lab
Gene Symbol Dhx38
Ensembl Gene ENSMUSG00000037993
Gene NameDEAH (Asp-Glu-Ala-His) box polypeptide 38
Synonyms5730550P09Rik, Ddx38, Prp16
MMRRC Submission 041116-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R4369 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location109548011-109565861 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 109553131 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 976 (V976I)
Ref Sequence ENSEMBL: ENSMUSP00000047865 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042601]
Predicted Effect probably damaging
Transcript: ENSMUST00000042601
AA Change: V976I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000047865
Gene: ENSMUSG00000037993
AA Change: V976I

DomainStartEndE-ValueType
Blast:DEXDc 3 146 2e-46 BLAST
low complexity region 147 204 N/A INTRINSIC
Blast:DEXDc 205 444 1e-105 BLAST
low complexity region 511 525 N/A INTRINSIC
DEXDc 531 715 6.88e-34 SMART
HELICc 759 862 1.11e-19 SMART
HA2 923 1013 3.22e-32 SMART
low complexity region 1163 1194 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212667
Meta Mutation Damage Score 0.2765 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. The protein encoded by this gene is a member of the DEAD/H box family of splicing factors. This protein resembles yeast Prp16 more closely than other DEAD/H family members. It is an ATPase and essential for the catalytic step II in pre-mRNA splicing process. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730596B20Rik A T 6: 52,179,062 probably benign Het
A730018C14Rik T C 12: 112,415,614 noncoding transcript Het
Abcc1 T G 16: 14,460,993 S1056A possibly damaging Het
Akr1c19 A T 13: 4,233,780 K4* probably null Het
Amph T A 13: 19,137,700 S516R probably benign Het
Apoh T C 11: 108,397,379 F108L probably damaging Het
Arg2 T C 12: 79,149,972 S156P probably damaging Het
AU018091 A T 7: 3,157,975 L582* probably null Het
Bckdk C T 7: 127,906,419 A238V probably benign Het
Bean1 T A 8: 104,217,110 V275D probably damaging Het
Brpf3 C T 17: 28,836,620 A1181V probably damaging Het
Cfb T C 17: 34,860,314 K287R probably damaging Het
Cpd T C 11: 76,797,711 N912D possibly damaging Het
Cyp4f14 T C 17: 32,909,258 N261S probably benign Het
Dennd3 T C 15: 73,540,809 I440T probably damaging Het
Dpep2 T G 8: 105,985,075 L573F probably benign Het
Ebag9 T C 15: 44,628,469 S86P probably benign Het
Epha1 T C 6: 42,365,457 Y319C probably damaging Het
Eps8l3 T C 3: 107,891,014 Y466H possibly damaging Het
Ercc6 A G 14: 32,517,207 E84G probably damaging Het
Ffar1 A G 7: 30,860,608 I288T probably benign Het
Flnb C T 14: 7,942,216 T2398I probably benign Het
Galnt15 T C 14: 32,029,539 F16S possibly damaging Het
Golgb1 A G 16: 36,916,907 E2172G probably damaging Het
Lhx4 T A 1: 155,704,814 H161L probably benign Het
Lrp1 T C 10: 127,550,286 N3457S possibly damaging Het
Map7d1 A T 4: 126,235,073 S436T probably damaging Het
Nmral1 T C 16: 4,714,530 Y139C probably damaging Het
Noc2l A G 4: 156,237,396 D84G possibly damaging Het
Olfr447 T A 6: 42,912,277 Y251* probably null Het
Olfr507 C T 7: 108,621,889 L26F probably benign Het
Osbpl11 T C 16: 33,224,648 S386P probably damaging Het
Papss2 A G 19: 32,641,391 H283R probably damaging Het
Pcdha11 T C 18: 37,006,743 V475A possibly damaging Het
Pglyrp3 T C 3: 92,028,079 I212T probably damaging Het
Pkhd1l1 C T 15: 44,505,553 R865W probably benign Het
Prdm9 T C 17: 15,544,446 T691A probably benign Het
Rnf121 T C 7: 102,024,106 D206G probably benign Het
Rnf122 T A 8: 31,112,149 M1K probably null Het
Shank2 T C 7: 144,179,781 S22P probably damaging Het
Smg6 C T 11: 74,932,443 R175* probably null Het
Speer3 C G 5: 13,796,380 A238G possibly damaging Het
Tcrg-V4 T C 13: 19,185,397 Y104H probably benign Het
Thsd7a C T 6: 12,468,908 C557Y probably damaging Het
Tiam2 A G 17: 3,413,967 probably benign Het
Ttn C T 2: 76,764,001 W18788* probably null Het
Vmn2r82 A T 10: 79,396,080 I638F probably benign Het
Zswim6 A G 13: 107,726,694 noncoding transcript Het
Other mutations in Dhx38
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Dhx38 APN 8 109556934 missense possibly damaging 0.49
IGL00821:Dhx38 APN 8 109555654 missense probably benign 0.00
IGL00910:Dhx38 APN 8 109559034 missense probably benign 0.07
IGL01011:Dhx38 APN 8 109562691 missense probably benign
IGL01401:Dhx38 APN 8 109552114 missense probably benign 0.15
IGL02133:Dhx38 APN 8 109558241 nonsense probably null
IGL02529:Dhx38 APN 8 109559013 missense probably benign 0.00
IGL02652:Dhx38 APN 8 109556129 missense probably damaging 1.00
IGL03241:Dhx38 APN 8 109562656 missense possibly damaging 0.47
IGL03378:Dhx38 APN 8 109559090 splice site probably null
R0358:Dhx38 UTSW 8 109552462 missense probably benign 0.13
R0375:Dhx38 UTSW 8 109555181 missense possibly damaging 0.89
R0437:Dhx38 UTSW 8 109558629 splice site probably benign
R0481:Dhx38 UTSW 8 109556216 splice site probably benign
R0492:Dhx38 UTSW 8 109561944 splice site probably benign
R0528:Dhx38 UTSW 8 109562661 missense probably benign 0.00
R0607:Dhx38 UTSW 8 109558943 missense probably benign 0.07
R1638:Dhx38 UTSW 8 109553545 missense probably damaging 1.00
R2020:Dhx38 UTSW 8 109556869 splice site probably benign
R2056:Dhx38 UTSW 8 109562720 unclassified probably benign
R2096:Dhx38 UTSW 8 109554259 missense probably damaging 1.00
R2152:Dhx38 UTSW 8 109560674 missense probably benign 0.00
R2154:Dhx38 UTSW 8 109560674 missense probably benign 0.00
R2382:Dhx38 UTSW 8 109556140 missense probably damaging 0.99
R4367:Dhx38 UTSW 8 109553131 missense probably damaging 1.00
R4368:Dhx38 UTSW 8 109553131 missense probably damaging 1.00
R5250:Dhx38 UTSW 8 109556520 missense probably damaging 1.00
R5354:Dhx38 UTSW 8 109555746 missense probably damaging 1.00
R5668:Dhx38 UTSW 8 109553416 missense probably damaging 1.00
R5777:Dhx38 UTSW 8 109556902 missense possibly damaging 0.81
R5784:Dhx38 UTSW 8 109559613 nonsense probably null
R6799:Dhx38 UTSW 8 109553202 missense probably damaging 1.00
R6915:Dhx38 UTSW 8 109559599 missense probably benign 0.15
R6932:Dhx38 UTSW 8 109552675 missense probably damaging 1.00
R7042:Dhx38 UTSW 8 109556985 missense possibly damaging 0.55
R7248:Dhx38 UTSW 8 109558927 missense probably benign 0.15
R7394:Dhx38 UTSW 8 109556523 missense probably damaging 1.00
R7513:Dhx38 UTSW 8 109560589 missense probably benign 0.00
R7569:Dhx38 UTSW 8 109560695 missense probably damaging 0.98
R8003:Dhx38 UTSW 8 109556140 missense probably damaging 0.99
R8071:Dhx38 UTSW 8 109558701 missense probably benign 0.10
R8537:Dhx38 UTSW 8 109553380 missense probably damaging 1.00
R8852:Dhx38 UTSW 8 109562729 nonsense probably null
R8860:Dhx38 UTSW 8 109562729 nonsense probably null
R8937:Dhx38 UTSW 8 109556466 missense probably damaging 0.96
Z1177:Dhx38 UTSW 8 109556085 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAGACTACGAGATTGAAGATGGTC -3'
(R):5'- GGACAGTTCTGCCCTTTGTC -3'

Sequencing Primer
(F):5'- TGACCCAGCCTTCCGAC -3'
(R):5'- TGTCCACTGTTGACTGCAG -3'
Posted On2015-07-06