Incidental Mutation 'R4369:Cpd'
ID 325908
Institutional Source Beutler Lab
Gene Symbol Cpd
Ensembl Gene ENSMUSG00000020841
Gene Name carboxypeptidase D
Synonyms D830034L15Rik
MMRRC Submission 041116-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.924) question?
Stock # R4369 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 76778424-76847018 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 76797711 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 912 (N912D)
Ref Sequence ENSEMBL: ENSMUSP00000021201 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021201]
AlphaFold O89001
Predicted Effect possibly damaging
Transcript: ENSMUST00000021201
AA Change: N912D

PolyPhen 2 Score 0.824 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000021201
Gene: ENSMUSG00000020841
AA Change: N912D

DomainStartEndE-ValueType
signal peptide 1 37 N/A INTRINSIC
Zn_pept 62 471 1.71e-52 SMART
Zn_pept 502 900 2.11e-66 SMART
Zn_pept 930 1195 1.11e-42 SMART
Pfam:CarboxypepD_reg 1211 1284 3.6e-10 PFAM
transmembrane domain 1297 1319 N/A INTRINSIC
low complexity region 1363 1371 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The metallocarboxypeptidase family of enzymes is divided into 2 subfamilies based on sequence similarities. The pancreatic carboxypeptidase-like and the regulatory B-type carboxypeptidase subfamilies. Carboxypeptidase D has been identified as a regulatory B-type carboxypeptidase. CPD is a homolog of duck gp180, a hepatitis B virus-binding protein. Transcript variants utilizing alternative polyadenylation signals exist for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730596B20Rik A T 6: 52,179,062 probably benign Het
A730018C14Rik T C 12: 112,415,614 noncoding transcript Het
Abcc1 T G 16: 14,460,993 S1056A possibly damaging Het
Akr1c19 A T 13: 4,233,780 K4* probably null Het
Amph T A 13: 19,137,700 S516R probably benign Het
Apoh T C 11: 108,397,379 F108L probably damaging Het
Arg2 T C 12: 79,149,972 S156P probably damaging Het
AU018091 A T 7: 3,157,975 L582* probably null Het
Bckdk C T 7: 127,906,419 A238V probably benign Het
Bean1 T A 8: 104,217,110 V275D probably damaging Het
Brpf3 C T 17: 28,836,620 A1181V probably damaging Het
Cfb T C 17: 34,860,314 K287R probably damaging Het
Cyp4f14 T C 17: 32,909,258 N261S probably benign Het
Dennd3 T C 15: 73,540,809 I440T probably damaging Het
Dhx38 C T 8: 109,553,131 V976I probably damaging Het
Dpep2 T G 8: 105,985,075 L573F probably benign Het
Ebag9 T C 15: 44,628,469 S86P probably benign Het
Epha1 T C 6: 42,365,457 Y319C probably damaging Het
Eps8l3 T C 3: 107,891,014 Y466H possibly damaging Het
Ercc6 A G 14: 32,517,207 E84G probably damaging Het
Ffar1 A G 7: 30,860,608 I288T probably benign Het
Flnb C T 14: 7,942,216 T2398I probably benign Het
Galnt15 T C 14: 32,029,539 F16S possibly damaging Het
Golgb1 A G 16: 36,916,907 E2172G probably damaging Het
Lhx4 T A 1: 155,704,814 H161L probably benign Het
Lrp1 T C 10: 127,550,286 N3457S possibly damaging Het
Map7d1 A T 4: 126,235,073 S436T probably damaging Het
Nmral1 T C 16: 4,714,530 Y139C probably damaging Het
Noc2l A G 4: 156,237,396 D84G possibly damaging Het
Olfr447 T A 6: 42,912,277 Y251* probably null Het
Olfr507 C T 7: 108,621,889 L26F probably benign Het
Osbpl11 T C 16: 33,224,648 S386P probably damaging Het
Papss2 A G 19: 32,641,391 H283R probably damaging Het
Pcdha11 T C 18: 37,006,743 V475A possibly damaging Het
Pglyrp3 T C 3: 92,028,079 I212T probably damaging Het
Pkhd1l1 C T 15: 44,505,553 R865W probably benign Het
Prdm9 T C 17: 15,544,446 T691A probably benign Het
Rnf121 T C 7: 102,024,106 D206G probably benign Het
Rnf122 T A 8: 31,112,149 M1K probably null Het
Shank2 T C 7: 144,179,781 S22P probably damaging Het
Smg6 C T 11: 74,932,443 R175* probably null Het
Speer3 C G 5: 13,796,380 A238G possibly damaging Het
Tcrg-V4 T C 13: 19,185,397 Y104H probably benign Het
Thsd7a C T 6: 12,468,908 C557Y probably damaging Het
Tiam2 A G 17: 3,413,967 probably benign Het
Ttn C T 2: 76,764,001 W18788* probably null Het
Vmn2r82 A T 10: 79,396,080 I638F probably benign Het
Zswim6 A G 13: 107,726,694 noncoding transcript Het
Other mutations in Cpd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Cpd APN 11 76797789 missense probably benign 0.00
IGL00698:Cpd APN 11 76840444 missense possibly damaging 0.82
IGL01025:Cpd APN 11 76795613 missense probably damaging 1.00
IGL01292:Cpd APN 11 76846245 missense possibly damaging 0.80
IGL01571:Cpd APN 11 76782296 missense probably damaging 1.00
IGL01606:Cpd APN 11 76812640 missense probably benign
IGL02283:Cpd APN 11 76840425 missense probably benign 0.19
IGL02895:Cpd APN 11 76785203 missense probably benign 0.06
IGL02965:Cpd APN 11 76790988 splice site probably benign
IGL03116:Cpd APN 11 76811713 missense probably damaging 1.00
IGL03178:Cpd APN 11 76806051 missense probably benign 0.02
PIT4280001:Cpd UTSW 11 76791024 missense probably benign 0.23
PIT4382001:Cpd UTSW 11 76797788 missense probably benign
R0050:Cpd UTSW 11 76792859 missense possibly damaging 0.94
R0054:Cpd UTSW 11 76790838 missense probably damaging 1.00
R0054:Cpd UTSW 11 76790838 missense probably damaging 1.00
R0320:Cpd UTSW 11 76840447 missense possibly damaging 0.50
R0416:Cpd UTSW 11 76785204 missense probably benign 0.13
R0556:Cpd UTSW 11 76802345 splice site probably benign
R0666:Cpd UTSW 11 76782327 missense probably damaging 1.00
R0668:Cpd UTSW 11 76784398 missense probably damaging 1.00
R1180:Cpd UTSW 11 76801753 missense possibly damaging 0.56
R1472:Cpd UTSW 11 76784398 missense probably damaging 0.98
R1518:Cpd UTSW 11 76840386 critical splice donor site probably null
R1617:Cpd UTSW 11 76846669 missense probably damaging 1.00
R1786:Cpd UTSW 11 76792798 missense probably benign 0.00
R1854:Cpd UTSW 11 76786338 missense probably damaging 1.00
R1861:Cpd UTSW 11 76784382 splice site probably benign
R2159:Cpd UTSW 11 76797641 missense probably damaging 0.96
R2205:Cpd UTSW 11 76802244 missense probably damaging 0.99
R2281:Cpd UTSW 11 76797801 missense probably benign 0.00
R2680:Cpd UTSW 11 76790999 missense probably benign
R2928:Cpd UTSW 11 76846374 missense probably benign
R2937:Cpd UTSW 11 76811859 missense probably damaging 1.00
R4133:Cpd UTSW 11 76814818 nonsense probably null
R4241:Cpd UTSW 11 76846785 missense probably benign 0.03
R4538:Cpd UTSW 11 76790999 missense probably benign
R4551:Cpd UTSW 11 76811886 missense probably damaging 1.00
R4617:Cpd UTSW 11 76840615 missense probably damaging 1.00
R4732:Cpd UTSW 11 76811794 missense probably damaging 0.99
R4733:Cpd UTSW 11 76811794 missense probably damaging 0.99
R4821:Cpd UTSW 11 76846237 missense probably benign 0.38
R4852:Cpd UTSW 11 76785150 missense probably benign 0.32
R4901:Cpd UTSW 11 76790881 missense probably damaging 1.00
R4988:Cpd UTSW 11 76814830 missense probably damaging 0.98
R4999:Cpd UTSW 11 76846222 critical splice donor site probably null
R5005:Cpd UTSW 11 76813570 missense probably damaging 1.00
R5092:Cpd UTSW 11 76811704 missense possibly damaging 0.75
R5438:Cpd UTSW 11 76791966 missense possibly damaging 0.65
R5524:Cpd UTSW 11 76797901 nonsense probably null
R5677:Cpd UTSW 11 76799825 missense probably benign
R5826:Cpd UTSW 11 76784416 nonsense probably null
R6031:Cpd UTSW 11 76790888 missense probably benign 0.00
R6031:Cpd UTSW 11 76790888 missense probably benign 0.00
R6103:Cpd UTSW 11 76799799 missense probably benign 0.00
R6257:Cpd UTSW 11 76812670 missense probably benign 0.37
R6263:Cpd UTSW 11 76846271 missense probably benign 0.00
R6485:Cpd UTSW 11 76808707 splice site probably null
R6671:Cpd UTSW 11 76795533 missense probably damaging 1.00
R6995:Cpd UTSW 11 76785055 missense probably benign 0.02
R7074:Cpd UTSW 11 76813594 missense probably damaging 1.00
R7192:Cpd UTSW 11 76814841 missense probably damaging 1.00
R7341:Cpd UTSW 11 76846953 missense unknown
R7371:Cpd UTSW 11 76846611 missense probably benign 0.25
R7380:Cpd UTSW 11 76802325 nonsense probably null
R7392:Cpd UTSW 11 76801779 missense probably damaging 1.00
R7410:Cpd UTSW 11 76782308 missense probably damaging 1.00
R7509:Cpd UTSW 11 76797876 missense probably benign 0.17
R7767:Cpd UTSW 11 76813559 missense probably benign 0.03
R8935:Cpd UTSW 11 76840469 missense probably damaging 1.00
R9151:Cpd UTSW 11 76784449 missense possibly damaging 0.54
R9172:Cpd UTSW 11 76784426 missense probably benign 0.21
R9173:Cpd UTSW 11 76808823 missense probably damaging 0.97
R9310:Cpd UTSW 11 76814781 nonsense probably null
R9666:Cpd UTSW 11 76802307 missense probably benign 0.02
Z1088:Cpd UTSW 11 76801746 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAATGAACCCGCTTAAACAGAG -3'
(R):5'- GTGTGCATCTGACCTGTATGC -3'

Sequencing Primer
(F):5'- GGAAGAAAACCAGGGTCATCTTAC -3'
(R):5'- GTTATAGGTATAACCCTGTCACCAAG -3'
Posted On 2015-07-06