Incidental Mutation 'R4369:Arg2'
ID325910
Institutional Source Beutler Lab
Gene Symbol Arg2
Ensembl Gene ENSMUSG00000021125
Gene Namearginase type II
SynonymsAII
MMRRC Submission 041116-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4369 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location79130777-79156301 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79149972 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 156 (S156P)
Ref Sequence ENSEMBL: ENSMUSP00000021550 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021550]
Predicted Effect probably damaging
Transcript: ENSMUST00000021550
AA Change: S156P

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000021550
Gene: ENSMUSG00000021125
AA Change: S156P

DomainStartEndE-ValueType
Pfam:Arginase 24 324 7.4e-80 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218917
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Arginase catalyzes the hydrolysis of arginine to ornithine and urea. At least two isoforms of mammalian arginase exists (types I and II) which differ in their tissue distribution, subcellular localization, immunologic crossreactivity and physiologic function. The type II isoform encoded by this gene, is located in the mitochondria and expressed in extra-hepatic tissues, especially kidney. The physiologic role of this isoform is poorly understood; it is thought to play a role in nitric oxide and polyamine metabolism. Transcript variants of the type II gene resulting from the use of alternative polyadenylation sites have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in elevated plasma arginine concentrations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730596B20Rik A T 6: 52,179,062 probably benign Het
A730018C14Rik T C 12: 112,415,614 noncoding transcript Het
Abcc1 T G 16: 14,460,993 S1056A possibly damaging Het
Akr1c19 A T 13: 4,233,780 K4* probably null Het
Amph T A 13: 19,137,700 S516R probably benign Het
Apoh T C 11: 108,397,379 F108L probably damaging Het
AU018091 A T 7: 3,157,975 L582* probably null Het
Bckdk C T 7: 127,906,419 A238V probably benign Het
Bean1 T A 8: 104,217,110 V275D probably damaging Het
Brpf3 C T 17: 28,836,620 A1181V probably damaging Het
Cfb T C 17: 34,860,314 K287R probably damaging Het
Cpd T C 11: 76,797,711 N912D possibly damaging Het
Cyp4f14 T C 17: 32,909,258 N261S probably benign Het
Dennd3 T C 15: 73,540,809 I440T probably damaging Het
Dhx38 C T 8: 109,553,131 V976I probably damaging Het
Dpep2 T G 8: 105,985,075 L573F probably benign Het
Ebag9 T C 15: 44,628,469 S86P probably benign Het
Epha1 T C 6: 42,365,457 Y319C probably damaging Het
Eps8l3 T C 3: 107,891,014 Y466H possibly damaging Het
Ercc6 A G 14: 32,517,207 E84G probably damaging Het
Ffar1 A G 7: 30,860,608 I288T probably benign Het
Flnb C T 14: 7,942,216 T2398I probably benign Het
Galnt15 T C 14: 32,029,539 F16S possibly damaging Het
Golgb1 A G 16: 36,916,907 E2172G probably damaging Het
Lhx4 T A 1: 155,704,814 H161L probably benign Het
Lrp1 T C 10: 127,550,286 N3457S possibly damaging Het
Map7d1 A T 4: 126,235,073 S436T probably damaging Het
Nmral1 T C 16: 4,714,530 Y139C probably damaging Het
Noc2l A G 4: 156,237,396 D84G possibly damaging Het
Olfr447 T A 6: 42,912,277 Y251* probably null Het
Olfr507 C T 7: 108,621,889 L26F probably benign Het
Osbpl11 T C 16: 33,224,648 S386P probably damaging Het
Papss2 A G 19: 32,641,391 H283R probably damaging Het
Pcdha11 T C 18: 37,006,743 V475A possibly damaging Het
Pglyrp3 T C 3: 92,028,079 I212T probably damaging Het
Pkhd1l1 C T 15: 44,505,553 R865W probably benign Het
Prdm9 T C 17: 15,544,446 T691A probably benign Het
Rnf121 T C 7: 102,024,106 D206G probably benign Het
Rnf122 T A 8: 31,112,149 M1K probably null Het
Shank2 T C 7: 144,179,781 S22P probably damaging Het
Smg6 C T 11: 74,932,443 R175* probably null Het
Speer3 C G 5: 13,796,380 A238G possibly damaging Het
Tcrg-V4 T C 13: 19,185,397 Y104H probably benign Het
Thsd7a C T 6: 12,468,908 C557Y probably damaging Het
Tiam2 A G 17: 3,413,967 probably benign Het
Ttn C T 2: 76,764,001 W18788* probably null Het
Vmn2r82 A T 10: 79,396,080 I638F probably benign Het
Zswim6 A G 13: 107,726,694 noncoding transcript Het
Other mutations in Arg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01546:Arg2 APN 12 79149859 splice site probably benign
IGL02494:Arg2 APN 12 79151923 missense probably benign 0.00
IGL02512:Arg2 APN 12 79147743 missense probably benign 0.01
IGL02543:Arg2 APN 12 79150759 missense probably benign 0.02
IGL02974:Arg2 APN 12 79150792 missense probably damaging 1.00
IGL03106:Arg2 APN 12 79149891 missense probably damaging 0.99
IGL03240:Arg2 APN 12 79131831 splice site probably null
R0119:Arg2 UTSW 12 79147612 missense probably damaging 1.00
R0136:Arg2 UTSW 12 79150006 missense probably damaging 1.00
R0299:Arg2 UTSW 12 79147612 missense probably damaging 1.00
R1856:Arg2 UTSW 12 79147662 missense probably benign
R1863:Arg2 UTSW 12 79150020 nonsense probably null
R4901:Arg2 UTSW 12 79147711 missense probably damaging 1.00
R7251:Arg2 UTSW 12 79150798 missense probably damaging 0.99
R8683:Arg2 UTSW 12 79150020 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGGCTAGACCCTGACTTTGC -3'
(R):5'- CTGCCCAGTCCTTAGTAATGTAC -3'

Sequencing Primer
(F):5'- AGACCCTGACTTTGCCCTGG -3'
(R):5'- ATCTCAAAGCCCCAGGAT -3'
Posted On2015-07-06