Incidental Mutation 'R4369:Ercc6'
ID325918
Institutional Source Beutler Lab
Gene Symbol Ercc6
Ensembl Gene ENSMUSG00000054051
Gene Nameexcision repair cross-complementing rodent repair deficiency, complementation group 6
SynonymsCS group B correcting gene, C130058G22Rik, CSB
MMRRC Submission 041116-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.511) question?
Stock #R4369 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location32513521-32580990 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32517207 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 84 (E84G)
Ref Sequence ENSEMBL: ENSMUSP00000066256 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066807]
Predicted Effect probably damaging
Transcript: ENSMUST00000066807
AA Change: E84G

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000066256
Gene: ENSMUSG00000054051
AA Change: E84G

DomainStartEndE-ValueType
PDB:4CVO|A 82 160 1e-36 PDB
low complexity region 286 299 N/A INTRINSIC
low complexity region 361 390 N/A INTRINSIC
low complexity region 422 434 N/A INTRINSIC
low complexity region 460 469 N/A INTRINSIC
low complexity region 479 491 N/A INTRINSIC
DEXDc 499 699 8.34e-33 SMART
Blast:DEXDc 720 821 7e-56 BLAST
HELICc 865 948 1.41e-21 SMART
low complexity region 1364 1377 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228017
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA-binding protein that is important in transcription-coupled excision repair. The encoded protein has ATP-stimulated ATPase activity, interacts with several transcription and excision repair proteins, and may promote complex formation at DNA repair sites. Mutations in this gene are associated with Cockayne syndrome type B and cerebrooculofacioskeletal syndrome 1. Alternative splicing occurs between a splice site from exon 5 of this gene to the 3' splice site upstream of the open reading frame (ORF) of the adjacent gene, piggyback-derived-3 (GeneID:267004), which activates the alternative polyadenylation site downstream of the piggyback-derived-3 ORF. The resulting transcripts encode a fusion protein that shares sequence with the product of each individual gene. [provided by RefSeq, Mar 2016]
PHENOTYPE: Homozygous mutant mice exhibit UV sensitivity, inactivation of transcription-coupled repair, increased incidence of induced skin and eye tumors, circling behavior, impaired coordination and lower body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730596B20Rik A T 6: 52,179,062 probably benign Het
A730018C14Rik T C 12: 112,415,614 noncoding transcript Het
Abcc1 T G 16: 14,460,993 S1056A possibly damaging Het
Akr1c19 A T 13: 4,233,780 K4* probably null Het
Amph T A 13: 19,137,700 S516R probably benign Het
Apoh T C 11: 108,397,379 F108L probably damaging Het
Arg2 T C 12: 79,149,972 S156P probably damaging Het
AU018091 A T 7: 3,157,975 L582* probably null Het
Bckdk C T 7: 127,906,419 A238V probably benign Het
Bean1 T A 8: 104,217,110 V275D probably damaging Het
Brpf3 C T 17: 28,836,620 A1181V probably damaging Het
Cfb T C 17: 34,860,314 K287R probably damaging Het
Cpd T C 11: 76,797,711 N912D possibly damaging Het
Cyp4f14 T C 17: 32,909,258 N261S probably benign Het
Dennd3 T C 15: 73,540,809 I440T probably damaging Het
Dhx38 C T 8: 109,553,131 V976I probably damaging Het
Dpep2 T G 8: 105,985,075 L573F probably benign Het
Ebag9 T C 15: 44,628,469 S86P probably benign Het
Epha1 T C 6: 42,365,457 Y319C probably damaging Het
Eps8l3 T C 3: 107,891,014 Y466H possibly damaging Het
Ffar1 A G 7: 30,860,608 I288T probably benign Het
Flnb C T 14: 7,942,216 T2398I probably benign Het
Galnt15 T C 14: 32,029,539 F16S possibly damaging Het
Golgb1 A G 16: 36,916,907 E2172G probably damaging Het
Lhx4 T A 1: 155,704,814 H161L probably benign Het
Lrp1 T C 10: 127,550,286 N3457S possibly damaging Het
Map7d1 A T 4: 126,235,073 S436T probably damaging Het
Nmral1 T C 16: 4,714,530 Y139C probably damaging Het
Noc2l A G 4: 156,237,396 D84G possibly damaging Het
Olfr447 T A 6: 42,912,277 Y251* probably null Het
Olfr507 C T 7: 108,621,889 L26F probably benign Het
Osbpl11 T C 16: 33,224,648 S386P probably damaging Het
Papss2 A G 19: 32,641,391 H283R probably damaging Het
Pcdha11 T C 18: 37,006,743 V475A possibly damaging Het
Pglyrp3 T C 3: 92,028,079 I212T probably damaging Het
Pkhd1l1 C T 15: 44,505,553 R865W probably benign Het
Prdm9 T C 17: 15,544,446 T691A probably benign Het
Rnf121 T C 7: 102,024,106 D206G probably benign Het
Rnf122 T A 8: 31,112,149 M1K probably null Het
Shank2 T C 7: 144,179,781 S22P probably damaging Het
Smg6 C T 11: 74,932,443 R175* probably null Het
Speer3 C G 5: 13,796,380 A238G possibly damaging Het
Tcrg-V4 T C 13: 19,185,397 Y104H probably benign Het
Thsd7a C T 6: 12,468,908 C557Y probably damaging Het
Tiam2 A G 17: 3,413,967 probably benign Het
Ttn C T 2: 76,764,001 W18788* probably null Het
Vmn2r82 A T 10: 79,396,080 I638F probably benign Het
Zswim6 A G 13: 107,726,694 noncoding transcript Het
Other mutations in Ercc6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Ercc6 APN 14 32568072 missense probably damaging 1.00
IGL00796:Ercc6 APN 14 32570002 missense probably benign 0.01
IGL00916:Ercc6 APN 14 32562655 intron probably benign
IGL01743:Ercc6 APN 14 32552604 missense probably damaging 1.00
IGL01802:Ercc6 APN 14 32562574 missense probably damaging 0.99
IGL01886:Ercc6 APN 14 32569580 missense possibly damaging 0.90
IGL02100:Ercc6 APN 14 32517095 missense probably benign 0.00
IGL02115:Ercc6 APN 14 32576993 missense probably damaging 1.00
IGL02755:Ercc6 APN 14 32575748 splice site probably benign
IGL02964:Ercc6 APN 14 32570103 missense probably benign 0.00
IGL02998:Ercc6 APN 14 32557857 missense probably benign 0.05
IGL03150:Ercc6 APN 14 32558574 missense probably damaging 0.96
R0152:Ercc6 UTSW 14 32546905 critical splice donor site probably benign
R0519:Ercc6 UTSW 14 32526842 missense probably damaging 1.00
R0591:Ercc6 UTSW 14 32558016 splice site probably benign
R0894:Ercc6 UTSW 14 32517028 missense probably benign 0.05
R0946:Ercc6 UTSW 14 32552621 missense probably benign 0.08
R1313:Ercc6 UTSW 14 32552720 splice site probably benign
R1506:Ercc6 UTSW 14 32569864 missense probably benign 0.01
R1528:Ercc6 UTSW 14 32519022 missense probably damaging 0.98
R1711:Ercc6 UTSW 14 32526176 missense probably damaging 1.00
R1753:Ercc6 UTSW 14 32576999 missense probably benign
R1795:Ercc6 UTSW 14 32517028 missense probably benign 0.05
R1843:Ercc6 UTSW 14 32546820 missense probably damaging 0.99
R1853:Ercc6 UTSW 14 32576816 missense possibly damaging 0.86
R1859:Ercc6 UTSW 14 32526778 missense probably damaging 1.00
R1912:Ercc6 UTSW 14 32576803 missense probably damaging 1.00
R2308:Ercc6 UTSW 14 32566409 missense possibly damaging 0.70
R2322:Ercc6 UTSW 14 32526317 missense probably damaging 1.00
R2386:Ercc6 UTSW 14 32541359 splice site probably null
R4170:Ercc6 UTSW 14 32566797 missense probably damaging 1.00
R4389:Ercc6 UTSW 14 32574908 nonsense probably null
R4747:Ercc6 UTSW 14 32569907 missense probably benign 0.00
R4811:Ercc6 UTSW 14 32574929 missense probably benign 0.20
R4840:Ercc6 UTSW 14 32541296 missense probably damaging 1.00
R4973:Ercc6 UTSW 14 32574902 missense probably damaging 1.00
R5068:Ercc6 UTSW 14 32570063 missense probably benign 0.01
R5069:Ercc6 UTSW 14 32570063 missense probably benign 0.01
R5070:Ercc6 UTSW 14 32570063 missense probably benign 0.01
R5093:Ercc6 UTSW 14 32567522 missense probably damaging 1.00
R5265:Ercc6 UTSW 14 32569623 missense probably benign 0.01
R5272:Ercc6 UTSW 14 32519028 nonsense probably null
R5499:Ercc6 UTSW 14 32516959 start codon destroyed probably null 0.98
R5795:Ercc6 UTSW 14 32526352 missense probably damaging 0.98
R6258:Ercc6 UTSW 14 32557856 missense probably benign 0.00
R6260:Ercc6 UTSW 14 32557856 missense probably benign 0.00
R6267:Ercc6 UTSW 14 32526403 nonsense probably null
R6291:Ercc6 UTSW 14 32569986 missense probably benign 0.01
R6296:Ercc6 UTSW 14 32526403 nonsense probably null
R6361:Ercc6 UTSW 14 32517110 missense probably benign 0.00
R6500:Ercc6 UTSW 14 32526823 missense probably damaging 0.96
R6555:Ercc6 UTSW 14 32517107 missense probably benign 0.15
R6724:Ercc6 UTSW 14 32566331 missense probably benign 0.01
R6925:Ercc6 UTSW 14 32562608 missense probably damaging 0.99
R7143:Ercc6 UTSW 14 32570305 missense probably damaging 1.00
R7327:Ercc6 UTSW 14 32526404 missense probably benign 0.19
R7396:Ercc6 UTSW 14 32569805 missense probably benign 0.00
R7529:Ercc6 UTSW 14 32560729 nonsense probably null
R7609:Ercc6 UTSW 14 32566361 missense probably benign 0.11
R7802:Ercc6 UTSW 14 32517303 missense probably damaging 1.00
R7854:Ercc6 UTSW 14 32566292 missense probably damaging 1.00
R7937:Ercc6 UTSW 14 32566292 missense probably damaging 1.00
R7995:Ercc6 UTSW 14 32562569 missense probably damaging 0.99
Z1176:Ercc6 UTSW 14 32526487 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- GGAGCAAGACTGTTTACCAAGTC -3'
(R):5'- AGAAGGCTCACACTCACATG -3'

Sequencing Primer
(F):5'- GACTGTTTACCAAGTCAGCATGC -3'
(R):5'- TCACATGAGGTCATCCAGGACTG -3'
Posted On2015-07-06