Incidental Mutation 'R4369:Papss2'
ID325936
Institutional Source Beutler Lab
Gene Symbol Papss2
Ensembl Gene ENSMUSG00000024899
Gene Name3'-phosphoadenosine 5'-phosphosulfate synthase 2
SynonymsSk2, Atpsk2, 1810018P12Rik
MMRRC Submission 041116-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.218) question?
Stock #R4369 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location32620005-32667187 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32641391 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 283 (H283R)
Ref Sequence ENSEMBL: ENSMUSP00000025833 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025833]
Predicted Effect probably damaging
Transcript: ENSMUST00000025833
AA Change: H283R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025833
Gene: ENSMUSG00000024899
AA Change: H283R

DomainStartEndE-ValueType
Pfam:APS_kinase 42 200 2.3e-74 PFAM
low complexity region 204 214 N/A INTRINSIC
Pfam:PUA_2 216 382 4e-52 PFAM
Pfam:ATP-sulfurylase 390 613 1.9e-70 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sulfation is a common modification of endogenous (lipids, proteins, and carbohydrates) and exogenous (xenobiotics and drugs) compounds. In mammals, the sulfate source is 3'-phosphoadenosine 5'-phosphosulfate (PAPS), created from ATP and inorganic sulfate. Two different tissue isoforms encoded by different genes synthesize PAPS. This gene encodes one of the two PAPS synthetases. Defects in this gene cause the Pakistani type of spondyloepimetaphyseal dysplasia. Two alternatively spliced transcript variants that encode different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for mutation s in this gene display delayed growth and shorter limbs and other abnormalities in bone formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730596B20Rik A T 6: 52,179,062 probably benign Het
A730018C14Rik T C 12: 112,415,614 noncoding transcript Het
Abcc1 T G 16: 14,460,993 S1056A possibly damaging Het
Akr1c19 A T 13: 4,233,780 K4* probably null Het
Amph T A 13: 19,137,700 S516R probably benign Het
Apoh T C 11: 108,397,379 F108L probably damaging Het
Arg2 T C 12: 79,149,972 S156P probably damaging Het
AU018091 A T 7: 3,157,975 L582* probably null Het
Bckdk C T 7: 127,906,419 A238V probably benign Het
Bean1 T A 8: 104,217,110 V275D probably damaging Het
Brpf3 C T 17: 28,836,620 A1181V probably damaging Het
Cfb T C 17: 34,860,314 K287R probably damaging Het
Cpd T C 11: 76,797,711 N912D possibly damaging Het
Cyp4f14 T C 17: 32,909,258 N261S probably benign Het
Dennd3 T C 15: 73,540,809 I440T probably damaging Het
Dhx38 C T 8: 109,553,131 V976I probably damaging Het
Dpep2 T G 8: 105,985,075 L573F probably benign Het
Ebag9 T C 15: 44,628,469 S86P probably benign Het
Epha1 T C 6: 42,365,457 Y319C probably damaging Het
Eps8l3 T C 3: 107,891,014 Y466H possibly damaging Het
Ercc6 A G 14: 32,517,207 E84G probably damaging Het
Ffar1 A G 7: 30,860,608 I288T probably benign Het
Flnb C T 14: 7,942,216 T2398I probably benign Het
Galnt15 T C 14: 32,029,539 F16S possibly damaging Het
Golgb1 A G 16: 36,916,907 E2172G probably damaging Het
Lhx4 T A 1: 155,704,814 H161L probably benign Het
Lrp1 T C 10: 127,550,286 N3457S possibly damaging Het
Map7d1 A T 4: 126,235,073 S436T probably damaging Het
Nmral1 T C 16: 4,714,530 Y139C probably damaging Het
Noc2l A G 4: 156,237,396 D84G possibly damaging Het
Olfr447 T A 6: 42,912,277 Y251* probably null Het
Olfr507 C T 7: 108,621,889 L26F probably benign Het
Osbpl11 T C 16: 33,224,648 S386P probably damaging Het
Pcdha11 T C 18: 37,006,743 V475A possibly damaging Het
Pglyrp3 T C 3: 92,028,079 I212T probably damaging Het
Pkhd1l1 C T 15: 44,505,553 R865W probably benign Het
Prdm9 T C 17: 15,544,446 T691A probably benign Het
Rnf121 T C 7: 102,024,106 D206G probably benign Het
Rnf122 T A 8: 31,112,149 M1K probably null Het
Shank2 T C 7: 144,179,781 S22P probably damaging Het
Smg6 C T 11: 74,932,443 R175* probably null Het
Speer3 C G 5: 13,796,380 A238G possibly damaging Het
Tcrg-V4 T C 13: 19,185,397 Y104H probably benign Het
Thsd7a C T 6: 12,468,908 C557Y probably damaging Het
Tiam2 A G 17: 3,413,967 probably benign Het
Ttn C T 2: 76,764,001 W18788* probably null Het
Vmn2r82 A T 10: 79,396,080 I638F probably benign Het
Zswim6 A G 13: 107,726,694 noncoding transcript Het
Other mutations in Papss2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01597:Papss2 APN 19 32638258 missense probably damaging 1.00
IGL01646:Papss2 APN 19 32652082 missense probably benign
IGL02052:Papss2 APN 19 32660583 missense possibly damaging 0.92
IGL02631:Papss2 APN 19 32634004 splice site probably benign
R0091:Papss2 UTSW 19 32633902 missense possibly damaging 0.94
R0116:Papss2 UTSW 19 32638368 nonsense probably null
R0708:Papss2 UTSW 19 32637216 missense probably damaging 0.97
R1336:Papss2 UTSW 19 32638315 missense possibly damaging 0.73
R1488:Papss2 UTSW 19 32637090 missense probably benign 0.02
R1931:Papss2 UTSW 19 32638968 nonsense probably null
R4025:Papss2 UTSW 19 32651923 missense probably damaging 0.98
R4762:Papss2 UTSW 19 32638978 missense probably benign 0.05
R5235:Papss2 UTSW 19 32639219 missense probably benign 0.00
R5294:Papss2 UTSW 19 32639000 missense probably benign 0.03
R5320:Papss2 UTSW 19 32638387 missense probably damaging 1.00
R5721:Papss2 UTSW 19 32660664 missense probably damaging 1.00
R5768:Papss2 UTSW 19 32660719 splice site probably null
R5982:Papss2 UTSW 19 32639236 missense probably benign
R6124:Papss2 UTSW 19 32637128 missense probably damaging 1.00
R6395:Papss2 UTSW 19 32664476 missense probably damaging 1.00
R6546:Papss2 UTSW 19 32663148 missense possibly damaging 0.78
R6571:Papss2 UTSW 19 32651942 splice site probably null
R7055:Papss2 UTSW 19 32664427 missense probably damaging 1.00
R7315:Papss2 UTSW 19 32639225 missense possibly damaging 0.60
R7726:Papss2 UTSW 19 32634003 splice site probably null
R7753:Papss2 UTSW 19 32620179 missense probably benign 0.00
R7991:Papss2 UTSW 19 32652003 missense possibly damaging 0.93
R8155:Papss2 UTSW 19 32641342 missense probably benign 0.24
R8275:Papss2 UTSW 19 32638360 missense probably damaging 1.00
X0028:Papss2 UTSW 19 32638395 splice site probably null
Predicted Primers PCR Primer
(F):5'- AGAGATGGAGACCTACCCTG -3'
(R):5'- AAGCCTTCATTTCTCAGCAAC -3'

Sequencing Primer
(F):5'- AGACCTACCCTGGGGCCTG -3'
(R):5'- ATTTCTCAGCAACTTGGCTTTAC -3'
Posted On2015-07-06