Incidental Mutation 'R4371:Camsap2'
ID325979
Institutional Source Beutler Lab
Gene Symbol Camsap2
Ensembl Gene ENSMUSG00000041570
Gene Namecalmodulin regulated spectrin-associated protein family, member 2
Synonyms1600013L13Rik, Camsap1l1, 4930541M15Rik
MMRRC Submission 041117-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.799) question?
Stock #R4371 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location136268123-136346104 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 136287963 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 337 (F337L)
Ref Sequence ENSEMBL: ENSMUSP00000041920 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048309] [ENSMUST00000192001] [ENSMUST00000192314]
Predicted Effect probably damaging
Transcript: ENSMUST00000048309
AA Change: F337L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000041920
Gene: ENSMUSG00000041570
AA Change: F337L

DomainStartEndE-ValueType
Pfam:CAMSAP_CH 239 322 3.6e-37 PFAM
low complexity region 379 388 N/A INTRINSIC
low complexity region 397 410 N/A INTRINSIC
low complexity region 483 491 N/A INTRINSIC
low complexity region 671 690 N/A INTRINSIC
low complexity region 706 711 N/A INTRINSIC
Pfam:CAMSAP_CC1 738 795 7.3e-28 PFAM
coiled coil region 878 916 N/A INTRINSIC
low complexity region 922 929 N/A INTRINSIC
low complexity region 943 956 N/A INTRINSIC
low complexity region 1028 1043 N/A INTRINSIC
low complexity region 1093 1107 N/A INTRINSIC
coiled coil region 1155 1227 N/A INTRINSIC
low complexity region 1242 1256 N/A INTRINSIC
CAMSAP_CKK 1337 1466 1.59e-86 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000192001
AA Change: F320L

PolyPhen 2 Score 0.904 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000142166
Gene: ENSMUSG00000041570
AA Change: F320L

DomainStartEndE-ValueType
Pfam:CH 178 324 1.1e-37 PFAM
Pfam:CAMSAP_CH 222 305 2.7e-36 PFAM
low complexity region 362 371 N/A INTRINSIC
low complexity region 380 393 N/A INTRINSIC
low complexity region 466 474 N/A INTRINSIC
low complexity region 654 673 N/A INTRINSIC
low complexity region 689 694 N/A INTRINSIC
coiled coil region 729 767 N/A INTRINSIC
coiled coil region 861 899 N/A INTRINSIC
low complexity region 905 912 N/A INTRINSIC
low complexity region 926 939 N/A INTRINSIC
low complexity region 1011 1026 N/A INTRINSIC
low complexity region 1076 1090 N/A INTRINSIC
coiled coil region 1138 1210 N/A INTRINSIC
low complexity region 1225 1239 N/A INTRINSIC
CAMSAP_CKK 1320 1449 1.59e-86 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000192314
AA Change: F331L

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000142299
Gene: ENSMUSG00000041570
AA Change: F331L

DomainStartEndE-ValueType
Pfam:CH 178 335 1.2e-35 PFAM
Pfam:CAMSAP_CH 233 316 3.2e-34 PFAM
low complexity region 373 382 N/A INTRINSIC
low complexity region 391 404 N/A INTRINSIC
low complexity region 477 485 N/A INTRINSIC
low complexity region 665 684 N/A INTRINSIC
low complexity region 700 705 N/A INTRINSIC
coiled coil region 740 778 N/A INTRINSIC
coiled coil region 872 910 N/A INTRINSIC
low complexity region 916 923 N/A INTRINSIC
low complexity region 937 950 N/A INTRINSIC
low complexity region 1022 1037 N/A INTRINSIC
low complexity region 1087 1101 N/A INTRINSIC
coiled coil region 1149 1221 N/A INTRINSIC
low complexity region 1236 1250 N/A INTRINSIC
CAMSAP_CKK 1331 1460 1.2e-90 SMART
Meta Mutation Damage Score 0.3487 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (41/41)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alg11 C A 8: 22,068,079 A469E probably benign Het
Alox12b G A 11: 69,169,616 R666H possibly damaging Het
Atp9a T C 2: 168,649,615 T677A probably damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Bckdk C T 7: 127,906,419 A238V probably benign Het
Brpf3 C T 17: 28,836,620 A1181V probably damaging Het
C9 A G 15: 6,491,484 D470G probably damaging Het
Cep152 G A 2: 125,613,047 R278W probably damaging Het
Cfb T C 17: 34,860,314 K287R probably damaging Het
Chfr G A 5: 110,136,168 R36H probably damaging Het
Cyp4f14 T C 17: 32,909,258 N261S probably benign Het
Drp2 A T X: 134,435,135 probably benign Het
Dzip3 A G 16: 48,943,455 probably null Het
Emb A T 13: 117,268,930 D296V probably damaging Het
Epha1 T C 6: 42,365,457 Y319C probably damaging Het
Flcn C T 11: 59,803,784 V121I possibly damaging Het
Glrp1 GTGCTGCTGCTGCTGCTGCTGCTGCTG GTGCTGCTGCTGCTGCTGCTGCTGCTGCTG 1: 88,503,275 probably benign Het
Gm6177 A T 1: 160,893,171 noncoding transcript Het
Hepacam2 A T 6: 3,486,988 V123E probably damaging Het
Iqsec1 A G 6: 90,694,606 S194P probably damaging Het
Kat6a T C 8: 22,911,929 I438T possibly damaging Het
Kcnmb2 A G 3: 32,156,102 probably null Het
Nbeal1 A T 1: 60,289,946 K2174N possibly damaging Het
Ncapg G A 5: 45,678,455 M409I probably benign Het
Ocstamp A G 2: 165,397,313 S318P possibly damaging Het
Olfr507 C T 7: 108,621,889 L26F probably benign Het
Phactr2 A G 10: 13,253,820 S235P probably damaging Het
Pom121l2 T C 13: 21,982,239 S227P probably benign Het
Sdf2 C T 11: 78,251,037 T66I probably damaging Het
Sptbn5 A G 2: 120,065,994 C729R probably damaging Het
Sys1 T C 2: 164,461,395 W10R probably damaging Het
Tfap4 A G 16: 4,551,999 I4T probably damaging Het
Thrb C A 14: 18,030,275 Q340K probably damaging Het
Tnc T C 4: 63,970,351 Y1735C probably damaging Het
Ubr1 A T 2: 120,895,066 probably null Het
Other mutations in Camsap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01306:Camsap2 APN 1 136297790 missense probably benign 0.23
IGL02727:Camsap2 APN 1 136304312 missense probably benign
IGL02803:Camsap2 APN 1 136281123 missense probably damaging 1.00
IGL03037:Camsap2 APN 1 136274857 missense probably damaging 1.00
IGL03124:Camsap2 APN 1 136274799 critical splice donor site probably null
IGL03189:Camsap2 APN 1 136281662 missense probably damaging 1.00
IGL03297:Camsap2 APN 1 136297801 missense probably benign
IGL03347:Camsap2 APN 1 136280986 missense possibly damaging 0.52
ANU23:Camsap2 UTSW 1 136297790 missense probably benign 0.23
PIT4366001:Camsap2 UTSW 1 136280317 missense
R0001:Camsap2 UTSW 1 136282888 unclassified probably benign
R0037:Camsap2 UTSW 1 136281892 missense probably damaging 1.00
R0140:Camsap2 UTSW 1 136280382 missense probably benign
R0194:Camsap2 UTSW 1 136292948 nonsense probably null
R0206:Camsap2 UTSW 1 136281000 missense probably damaging 1.00
R0208:Camsap2 UTSW 1 136281000 missense probably damaging 1.00
R0517:Camsap2 UTSW 1 136293388 missense possibly damaging 0.95
R0648:Camsap2 UTSW 1 136304319 missense probably damaging 0.96
R0735:Camsap2 UTSW 1 136292888 missense probably damaging 1.00
R0790:Camsap2 UTSW 1 136273737 splice site probably benign
R0880:Camsap2 UTSW 1 136280970 missense probably benign 0.08
R1559:Camsap2 UTSW 1 136282094 missense probably benign 0.02
R1728:Camsap2 UTSW 1 136281315 missense probably benign 0.00
R1729:Camsap2 UTSW 1 136281315 missense probably benign 0.00
R1730:Camsap2 UTSW 1 136281315 missense probably benign 0.00
R1739:Camsap2 UTSW 1 136281315 missense probably benign 0.00
R1762:Camsap2 UTSW 1 136281315 missense probably benign 0.00
R1783:Camsap2 UTSW 1 136281315 missense probably benign 0.00
R1784:Camsap2 UTSW 1 136281315 missense probably benign 0.00
R1785:Camsap2 UTSW 1 136281315 missense probably benign 0.00
R1823:Camsap2 UTSW 1 136273783 missense possibly damaging 0.65
R1824:Camsap2 UTSW 1 136273783 missense possibly damaging 0.65
R1997:Camsap2 UTSW 1 136271545 missense probably damaging 1.00
R2010:Camsap2 UTSW 1 136274868 missense probably damaging 1.00
R2237:Camsap2 UTSW 1 136345331 missense probably damaging 1.00
R2923:Camsap2 UTSW 1 136280809 missense possibly damaging 0.95
R4275:Camsap2 UTSW 1 136270876 missense probably benign 0.01
R4976:Camsap2 UTSW 1 136304386 missense probably damaging 1.00
R5227:Camsap2 UTSW 1 136274891 intron probably benign
R5513:Camsap2 UTSW 1 136280863 missense probably benign 0.23
R5755:Camsap2 UTSW 1 136282327 missense probably damaging 1.00
R5834:Camsap2 UTSW 1 136280388 missense probably benign
R5966:Camsap2 UTSW 1 136276592 missense probably damaging 1.00
R6031:Camsap2 UTSW 1 136280438 missense possibly damaging 0.46
R6031:Camsap2 UTSW 1 136280438 missense possibly damaging 0.46
R6111:Camsap2 UTSW 1 136281298 missense probably benign
R6147:Camsap2 UTSW 1 136345400 missense probably damaging 1.00
R6284:Camsap2 UTSW 1 136304437 missense possibly damaging 0.63
R6293:Camsap2 UTSW 1 136287920 missense probably damaging 1.00
R6306:Camsap2 UTSW 1 136281199 missense probably benign
R6403:Camsap2 UTSW 1 136280800 nonsense probably null
R6410:Camsap2 UTSW 1 136345444 start gained probably benign
R6943:Camsap2 UTSW 1 136304449 missense probably damaging 1.00
R7268:Camsap2 UTSW 1 136273745 splice site probably null
R7448:Camsap2 UTSW 1 136270906 missense
R7472:Camsap2 UTSW 1 136281393 missense probably damaging 0.96
R7478:Camsap2 UTSW 1 136270940 missense
R7515:Camsap2 UTSW 1 136345370 missense probably damaging 0.99
R7691:Camsap2 UTSW 1 136293004 missense probably damaging 0.99
R7800:Camsap2 UTSW 1 136281901 missense probably damaging 0.99
R8040:Camsap2 UTSW 1 136281247 missense
X0018:Camsap2 UTSW 1 136276575 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCTGCCTTGACTACTAAAACATTAG -3'
(R):5'- ATCAGAGGCCTGGACATGTG -3'

Sequencing Primer
(F):5'- AGTCTACAGAGCTTCTTCCAGGAC -3'
(R):5'- CCTGGACATGTGTGGTTACAAG -3'
Posted On2015-07-06