Incidental Mutation 'R4371:B4galt3'
ID 325981
Institutional Source Beutler Lab
Gene Symbol B4galt3
Ensembl Gene ENSMUSG00000052423
Gene Name UDP-Gal:betaGlcNAc beta 1,4-galactosyltransferase, polypeptide 3
Synonyms ESTM26, 9530061M23Rik, beta4GalT-III, R74981
MMRRC Submission 041117-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.454) question?
Stock # R4371 (G1)
Quality Score 225
Status Validated
Chromosome 1
Chromosomal Location 171097898-171104468 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 171101613 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Asparagine at position 196 (H196N)
Ref Sequence ENSEMBL: ENSMUSP00000106945 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064272] [ENSMUST00000073120] [ENSMUST00000111313] [ENSMUST00000126699] [ENSMUST00000141999] [ENSMUST00000192956] [ENSMUST00000141114] [ENSMUST00000151863]
AlphaFold Q91YY2
Predicted Effect probably damaging
Transcript: ENSMUST00000064272
AA Change: H196N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000066353
Gene: ENSMUSG00000052423
AA Change: H196N

DomainStartEndE-ValueType
transmembrane domain 12 31 N/A INTRINSIC
low complexity region 61 77 N/A INTRINSIC
Pfam:Glyco_transf_7N 79 212 1.7e-59 PFAM
Pfam:Glyco_transf_7C 217 294 6.3e-32 PFAM
low complexity region 348 364 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000073120
SMART Domains Protein: ENSMUSP00000072863
Gene: ENSMUSG00000062729

DomainStartEndE-ValueType
Pfam:NAD_binding_8 7 74 1.3e-9 PFAM
Pfam:Amino_oxidase 12 471 1.7e-64 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111313
AA Change: H196N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106945
Gene: ENSMUSG00000052423
AA Change: H196N

DomainStartEndE-ValueType
transmembrane domain 12 31 N/A INTRINSIC
low complexity region 61 77 N/A INTRINSIC
Pfam:Glyco_transf_7N 79 214 2.1e-74 PFAM
Pfam:Glyco_transf_7C 217 294 1.7e-31 PFAM
Pfam:Glyco_tranf_2_2 238 298 1e-6 PFAM
low complexity region 348 364 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123954
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125939
Predicted Effect probably benign
Transcript: ENSMUST00000126699
SMART Domains Protein: ENSMUSP00000141958
Gene: ENSMUSG00000052423

DomainStartEndE-ValueType
Pfam:Glyco_transf_7C 1 72 3.2e-28 PFAM
Pfam:Glyco_tranf_2_2 16 76 2.1e-5 PFAM
low complexity region 126 142 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126765
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129985
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132890
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155083
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152689
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138904
Predicted Effect probably benign
Transcript: ENSMUST00000141999
SMART Domains Protein: ENSMUSP00000114926
Gene: ENSMUSG00000052423

DomainStartEndE-ValueType
transmembrane domain 12 34 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000192956
SMART Domains Protein: ENSMUSP00000141835
Gene: ENSMUSG00000062729

DomainStartEndE-ValueType
Pfam:NAD_binding_8 7 72 1.6e-7 PFAM
Pfam:Amino_oxidase 12 389 4.7e-29 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141114
SMART Domains Protein: ENSMUSP00000114560
Gene: ENSMUSG00000052423

DomainStartEndE-ValueType
low complexity region 86 102 N/A INTRINSIC
Pfam:Glyco_transf_7N 104 139 2.6e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151863
Meta Mutation Damage Score 0.5682 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of seven beta-1,4-galactosyltransferase (beta4GalT) genes. They encode type II membrane-bound glycoproteins that appear to have exclusive specificity for the donor substrate UDP-galactose; all transfer galactose in a beta1,4 linkage to similar acceptor sugars: GlcNAc, Glc, and Xyl. Each beta4GalT has a distinct function in the biosynthesis of different glycoconjugates and saccharide structures. As type II membrane proteins, they have an N-terminal hydrophobic signal sequence that directs the protein to the Golgi apparatus and which then remains uncleaved to function as a transmembrane anchor. By sequence similarity, the beta4GalTs form four groups: beta4GalT1 and beta4GalT2, beta4GalT3 and beta4GalT4, beta4GalT5 and beta4GalT6, and beta4GalT7. This gene encodes an enzyme that may be mainly involved in the synthesis of the first N-acetyllactosamine unit of poly-N-acetyllactosamine chains. Multiple alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Dec 2010]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alg11 C A 8: 22,558,095 (GRCm39) A469E probably benign Het
Alox12b G A 11: 69,060,442 (GRCm39) R666H possibly damaging Het
Atp9a T C 2: 168,491,535 (GRCm39) T677A probably damaging Het
Bckdk C T 7: 127,505,591 (GRCm39) A238V probably benign Het
Brpf3 C T 17: 29,055,594 (GRCm39) A1181V probably damaging Het
C9 A G 15: 6,520,965 (GRCm39) D470G probably damaging Het
Camsap2 A G 1: 136,215,701 (GRCm39) F337L probably damaging Het
Cep152 G A 2: 125,454,967 (GRCm39) R278W probably damaging Het
Cfb T C 17: 35,079,290 (GRCm39) K287R probably damaging Het
Chfr G A 5: 110,284,034 (GRCm39) R36H probably damaging Het
Cyp4f14 T C 17: 33,128,232 (GRCm39) N261S probably benign Het
Drp2 A T X: 133,335,884 (GRCm39) probably benign Het
Dzip3 A G 16: 48,763,818 (GRCm39) probably null Het
Emb A T 13: 117,405,466 (GRCm39) D296V probably damaging Het
Epha1 T C 6: 42,342,391 (GRCm39) Y319C probably damaging Het
Flcn C T 11: 59,694,610 (GRCm39) V121I possibly damaging Het
Glrp1 GTGCTGCTGCTGCTGCTGCTGCTGCTG GTGCTGCTGCTGCTGCTGCTGCTGCTGCTG 1: 88,430,997 (GRCm39) probably benign Het
Gm6177 A T 1: 160,720,741 (GRCm39) noncoding transcript Het
Hepacam2 A T 6: 3,486,988 (GRCm39) V123E probably damaging Het
Iqsec1 A G 6: 90,671,588 (GRCm39) S194P probably damaging Het
Kat6a T C 8: 23,401,945 (GRCm39) I438T possibly damaging Het
Kcnmb2 A G 3: 32,210,251 (GRCm39) probably null Het
Nbeal1 A T 1: 60,329,105 (GRCm39) K2174N possibly damaging Het
Ncapg G A 5: 45,835,797 (GRCm39) M409I probably benign Het
Ocstamp A G 2: 165,239,233 (GRCm39) S318P possibly damaging Het
Or5p79 C T 7: 108,221,096 (GRCm39) L26F probably benign Het
Phactr2 A G 10: 13,129,564 (GRCm39) S235P probably damaging Het
Pom121l2 T C 13: 22,166,409 (GRCm39) S227P probably benign Het
Sdf2 C T 11: 78,141,863 (GRCm39) T66I probably damaging Het
Sptbn5 A G 2: 119,896,475 (GRCm39) C729R probably damaging Het
Sys1 T C 2: 164,303,315 (GRCm39) W10R probably damaging Het
Tfap4 A G 16: 4,369,863 (GRCm39) I4T probably damaging Het
Thrb C A 14: 18,030,275 (GRCm38) Q340K probably damaging Het
Tnc T C 4: 63,888,588 (GRCm39) Y1735C probably damaging Het
Ubr1 A T 2: 120,725,547 (GRCm39) probably null Het
Other mutations in B4galt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02019:B4galt3 APN 1 171,099,362 (GRCm39) missense probably damaging 1.00
BB004:B4galt3 UTSW 1 171,099,342 (GRCm39) nonsense probably null
BB014:B4galt3 UTSW 1 171,099,342 (GRCm39) nonsense probably null
R0026:B4galt3 UTSW 1 171,101,831 (GRCm39) unclassified probably benign
R0126:B4galt3 UTSW 1 171,103,738 (GRCm39) missense probably damaging 0.97
R0537:B4galt3 UTSW 1 171,101,821 (GRCm39) unclassified probably benign
R1478:B4galt3 UTSW 1 171,103,938 (GRCm39) missense probably benign 0.11
R2012:B4galt3 UTSW 1 171,100,118 (GRCm39) missense probably damaging 1.00
R2206:B4galt3 UTSW 1 171,101,613 (GRCm39) missense probably damaging 1.00
R2207:B4galt3 UTSW 1 171,101,613 (GRCm39) missense probably damaging 1.00
R2223:B4galt3 UTSW 1 171,101,613 (GRCm39) missense probably damaging 1.00
R2353:B4galt3 UTSW 1 171,101,613 (GRCm39) missense probably damaging 1.00
R2354:B4galt3 UTSW 1 171,101,613 (GRCm39) missense probably damaging 1.00
R2438:B4galt3 UTSW 1 171,101,613 (GRCm39) missense probably damaging 1.00
R2439:B4galt3 UTSW 1 171,101,613 (GRCm39) missense probably damaging 1.00
R3039:B4galt3 UTSW 1 171,101,613 (GRCm39) missense probably damaging 1.00
R3051:B4galt3 UTSW 1 171,101,613 (GRCm39) missense probably damaging 1.00
R3709:B4galt3 UTSW 1 171,101,613 (GRCm39) missense probably damaging 1.00
R3710:B4galt3 UTSW 1 171,101,613 (GRCm39) missense probably damaging 1.00
R3741:B4galt3 UTSW 1 171,101,613 (GRCm39) missense probably damaging 1.00
R3742:B4galt3 UTSW 1 171,101,613 (GRCm39) missense probably damaging 1.00
R3813:B4galt3 UTSW 1 171,101,613 (GRCm39) missense probably damaging 1.00
R3953:B4galt3 UTSW 1 171,101,613 (GRCm39) missense probably damaging 1.00
R4058:B4galt3 UTSW 1 171,101,613 (GRCm39) missense probably damaging 1.00
R4059:B4galt3 UTSW 1 171,101,613 (GRCm39) missense probably damaging 1.00
R4323:B4galt3 UTSW 1 171,103,515 (GRCm39) missense possibly damaging 0.93
R4367:B4galt3 UTSW 1 171,101,613 (GRCm39) missense probably damaging 1.00
R4368:B4galt3 UTSW 1 171,101,613 (GRCm39) missense probably damaging 1.00
R4370:B4galt3 UTSW 1 171,101,613 (GRCm39) missense probably damaging 1.00
R4486:B4galt3 UTSW 1 171,099,343 (GRCm39) missense possibly damaging 0.94
R4538:B4galt3 UTSW 1 171,100,280 (GRCm39) missense probably damaging 1.00
R5557:B4galt3 UTSW 1 171,100,089 (GRCm39) critical splice acceptor site probably null
R7313:B4galt3 UTSW 1 171,100,319 (GRCm39) missense probably damaging 1.00
R7927:B4galt3 UTSW 1 171,099,342 (GRCm39) nonsense probably null
R8222:B4galt3 UTSW 1 171,100,253 (GRCm39) missense possibly damaging 0.46
R8552:B4galt3 UTSW 1 171,101,917 (GRCm39) missense possibly damaging 0.70
R8804:B4galt3 UTSW 1 171,103,947 (GRCm39) missense probably benign 0.33
R8859:B4galt3 UTSW 1 171,099,241 (GRCm39) missense unknown
R9150:B4galt3 UTSW 1 171,103,899 (GRCm39) missense probably benign
R9265:B4galt3 UTSW 1 171,101,617 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTGGGTGCTCTCTTCACT -3'
(R):5'- TCCGCCAAAGTACTGGGG -3'

Sequencing Primer
(F):5'- GGGTGCTCTCTTCACTTTGGC -3'
(R):5'- AGATCCCTGCGGTTCACAAATTTG -3'
Posted On 2015-07-06