Incidental Mutation 'R4371:Epha1'
ID325995
Institutional Source Beutler Lab
Gene Symbol Epha1
Ensembl Gene ENSMUSG00000029859
Gene NameEph receptor A1
SynonymsEph, 5730453L17Rik, Esk
MMRRC Submission 041117-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.147) question?
Stock #R4371 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location42358487-42373268 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 42365457 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 319 (Y319C)
Ref Sequence ENSEMBL: ENSMUSP00000073099 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073387] [ENSMUST00000204357]
PDB Structure
The solution structure of the second fibronectin type III domain of mouse Ephrin type-A receptor 1 [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000073387
AA Change: Y319C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000073099
Gene: ENSMUSG00000029859
AA Change: Y319C

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
EPH_lbd 28 205 3.23e-103 SMART
FN3 334 430 8.43e-9 SMART
FN3 448 526 1.59e-4 SMART
Pfam:EphA2_TM 549 622 3.4e-13 PFAM
TyrKc 625 881 2.57e-126 SMART
SAM 911 977 4.13e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204238
Predicted Effect probably damaging
Transcript: ENSMUST00000204357
AA Change: Y319C

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000144763
Gene: ENSMUSG00000029859
AA Change: Y319C

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
EPH_lbd 28 205 1.1e-105 SMART
FN3 334 430 4.2e-11 SMART
low complexity region 459 473 N/A INTRINSIC
FN3 483 563 2.4e-8 SMART
Pfam:EphA2_TM 586 659 7.6e-11 PFAM
STYKc 662 849 1.1e-65 SMART
SAM 879 945 2.5e-21 SMART
Meta Mutation Damage Score 0.5350 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the ephrin receptor subfamily of the protein-tyrosine kinase family. EPH and EPH-related receptors have been implicated in mediating developmental events, particularly in the nervous system. Receptors in the EPH subfamily typically have a single kinase domain and an extracellular region containing a Cys-rich domain and 2 fibronectin type III repeats. The ephrin receptors are divided into 2 groups based on the similarity of their extracellular domain sequences and their affinities for binding ephrin-A and ephrin-B ligands. This gene is expressed in some human cancer cell lines and has been implicated in carcinogenesis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Most mice homozygous for a null allele exhibit a kinked tail while 18% of mice exhibit vagina atresia with hydrometrocolops and infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alg11 C A 8: 22,068,079 A469E probably benign Het
Alox12b G A 11: 69,169,616 R666H possibly damaging Het
Atp9a T C 2: 168,649,615 T677A probably damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Bckdk C T 7: 127,906,419 A238V probably benign Het
Brpf3 C T 17: 28,836,620 A1181V probably damaging Het
C9 A G 15: 6,491,484 D470G probably damaging Het
Camsap2 A G 1: 136,287,963 F337L probably damaging Het
Cep152 G A 2: 125,613,047 R278W probably damaging Het
Cfb T C 17: 34,860,314 K287R probably damaging Het
Chfr G A 5: 110,136,168 R36H probably damaging Het
Cyp4f14 T C 17: 32,909,258 N261S probably benign Het
Drp2 A T X: 134,435,135 probably benign Het
Dzip3 A G 16: 48,943,455 probably null Het
Emb A T 13: 117,268,930 D296V probably damaging Het
Flcn C T 11: 59,803,784 V121I possibly damaging Het
Glrp1 GTGCTGCTGCTGCTGCTGCTGCTGCTG GTGCTGCTGCTGCTGCTGCTGCTGCTGCTG 1: 88,503,275 probably benign Het
Gm6177 A T 1: 160,893,171 noncoding transcript Het
Hepacam2 A T 6: 3,486,988 V123E probably damaging Het
Iqsec1 A G 6: 90,694,606 S194P probably damaging Het
Kat6a T C 8: 22,911,929 I438T possibly damaging Het
Kcnmb2 A G 3: 32,156,102 probably null Het
Nbeal1 A T 1: 60,289,946 K2174N possibly damaging Het
Ncapg G A 5: 45,678,455 M409I probably benign Het
Ocstamp A G 2: 165,397,313 S318P possibly damaging Het
Olfr507 C T 7: 108,621,889 L26F probably benign Het
Phactr2 A G 10: 13,253,820 S235P probably damaging Het
Pom121l2 T C 13: 21,982,239 S227P probably benign Het
Sdf2 C T 11: 78,251,037 T66I probably damaging Het
Sptbn5 A G 2: 120,065,994 C729R probably damaging Het
Sys1 T C 2: 164,461,395 W10R probably damaging Het
Tfap4 A G 16: 4,551,999 I4T probably damaging Het
Thrb C A 14: 18,030,275 Q340K probably damaging Het
Tnc T C 4: 63,970,351 Y1735C probably damaging Het
Ubr1 A T 2: 120,895,066 probably null Het
Other mutations in Epha1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01591:Epha1 APN 6 42360551 missense probably damaging 1.00
IGL02388:Epha1 APN 6 42365016 missense probably damaging 1.00
IGL02614:Epha1 APN 6 42360557 missense probably benign 0.02
IGL03019:Epha1 APN 6 42362752 missense probably damaging 1.00
buddy UTSW 6 42361451 missense probably damaging 1.00
R0369:Epha1 UTSW 6 42365473 missense probably damaging 1.00
R0894:Epha1 UTSW 6 42363822 missense probably benign 0.45
R1353:Epha1 UTSW 6 42361837 missense probably damaging 0.99
R1451:Epha1 UTSW 6 42361451 missense probably damaging 1.00
R1840:Epha1 UTSW 6 42363588 missense probably damaging 0.99
R2064:Epha1 UTSW 6 42366053 missense probably benign 0.01
R2065:Epha1 UTSW 6 42366053 missense probably benign 0.01
R2067:Epha1 UTSW 6 42366053 missense probably benign 0.01
R2087:Epha1 UTSW 6 42363568 missense probably benign 0.01
R3691:Epha1 UTSW 6 42361130 missense probably damaging 1.00
R3952:Epha1 UTSW 6 42364285 missense probably damaging 0.99
R4111:Epha1 UTSW 6 42358838 missense possibly damaging 0.88
R4280:Epha1 UTSW 6 42365052 missense probably damaging 1.00
R4369:Epha1 UTSW 6 42365457 missense probably damaging 1.00
R4491:Epha1 UTSW 6 42360666 missense probably damaging 1.00
R4743:Epha1 UTSW 6 42372221 missense probably benign 0.00
R4838:Epha1 UTSW 6 42363816 missense probably benign 0.04
R4847:Epha1 UTSW 6 42361914 missense possibly damaging 0.88
R4857:Epha1 UTSW 6 42361482 missense probably benign 0.00
R4884:Epha1 UTSW 6 42360734 missense probably damaging 0.99
R4929:Epha1 UTSW 6 42364599 missense probably benign 0.05
R5239:Epha1 UTSW 6 42365010 missense possibly damaging 0.87
R5416:Epha1 UTSW 6 42365871 missense probably damaging 1.00
R5595:Epha1 UTSW 6 42364634 missense possibly damaging 0.78
R5838:Epha1 UTSW 6 42361646 missense probably damaging 1.00
R6395:Epha1 UTSW 6 42366172 missense probably damaging 1.00
R6594:Epha1 UTSW 6 42364691 missense probably benign
R6639:Epha1 UTSW 6 42365935 nonsense probably null
R7092:Epha1 UTSW 6 42364245 missense probably benign 0.36
R7569:Epha1 UTSW 6 42365422 missense possibly damaging 0.70
R7705:Epha1 UTSW 6 42362668 missense probably damaging 0.99
R7802:Epha1 UTSW 6 42361941 missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- CTCTGCATTCTAGAGAGGACAG -3'
(R):5'- AGGTCCCCAAACAAGGCTTC -3'

Sequencing Primer
(F):5'- CATTCTAGAGAGGACAGAGGGC -3'
(R):5'- AGCCTGTCCTACTGGTTT -3'
Posted On2015-07-06