Incidental Mutation 'R4371:Flcn'
ID326002
Institutional Source Beutler Lab
Gene Symbol Flcn
Ensembl Gene ENSMUSG00000032633
Gene Namefolliculin
SynonymsB430214A04Rik, BHD
MMRRC Submission 041117-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4371 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location59791408-59810016 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 59803784 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 121 (V121I)
Ref Sequence ENSEMBL: ENSMUSP00000099758 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047706] [ENSMUST00000091246] [ENSMUST00000102697]
Predicted Effect probably benign
Transcript: ENSMUST00000047706
SMART Domains Protein: ENSMUSP00000037675
Gene: ENSMUSG00000032633

DomainStartEndE-ValueType
low complexity region 62 79 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000091246
AA Change: V121I

PolyPhen 2 Score 0.903 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000091696
Gene: ENSMUSG00000032633
AA Change: V121I

DomainStartEndE-ValueType
low complexity region 62 79 N/A INTRINSIC
Pfam:Folliculin 103 267 3.5e-59 PFAM
low complexity region 293 308 N/A INTRINSIC
PDB:3V42|B 342 566 1e-144 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000102697
AA Change: V121I

PolyPhen 2 Score 0.903 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099758
Gene: ENSMUSG00000032633
AA Change: V121I

DomainStartEndE-ValueType
low complexity region 62 79 N/A INTRINSIC
Pfam:Folliculin 104 265 1.5e-55 PFAM
low complexity region 293 308 N/A INTRINSIC
Pfam:Folliculin_C 344 566 8.4e-94 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133647
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148151
Meta Mutation Damage Score 0.0665 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is located within the Smith-Magenis syndrome region on chromosome 17. Mutations in this gene are associated with Birt-Hogg-Dube syndrome, which is characterized by fibrofolliculomas, renal tumors, lung cysts, and pneumothorax. Alternative splicing of this gene results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for either of two different knock-out alleles exhibit prenatal lethality. Mice homozygous for a gene-trapped allele show prenatal lethality while a fraction of heterozygotes develop spontaneous oncocytic renal cysts and solid renal tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alg11 C A 8: 22,068,079 A469E probably benign Het
Alox12b G A 11: 69,169,616 R666H possibly damaging Het
Atp9a T C 2: 168,649,615 T677A probably damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Bckdk C T 7: 127,906,419 A238V probably benign Het
Brpf3 C T 17: 28,836,620 A1181V probably damaging Het
C9 A G 15: 6,491,484 D470G probably damaging Het
Camsap2 A G 1: 136,287,963 F337L probably damaging Het
Cep152 G A 2: 125,613,047 R278W probably damaging Het
Cfb T C 17: 34,860,314 K287R probably damaging Het
Chfr G A 5: 110,136,168 R36H probably damaging Het
Cyp4f14 T C 17: 32,909,258 N261S probably benign Het
Drp2 A T X: 134,435,135 probably benign Het
Dzip3 A G 16: 48,943,455 probably null Het
Emb A T 13: 117,268,930 D296V probably damaging Het
Epha1 T C 6: 42,365,457 Y319C probably damaging Het
Glrp1 GTGCTGCTGCTGCTGCTGCTGCTGCTG GTGCTGCTGCTGCTGCTGCTGCTGCTGCTG 1: 88,503,275 probably benign Het
Gm6177 A T 1: 160,893,171 noncoding transcript Het
Hepacam2 A T 6: 3,486,988 V123E probably damaging Het
Iqsec1 A G 6: 90,694,606 S194P probably damaging Het
Kat6a T C 8: 22,911,929 I438T possibly damaging Het
Kcnmb2 A G 3: 32,156,102 probably null Het
Nbeal1 A T 1: 60,289,946 K2174N possibly damaging Het
Ncapg G A 5: 45,678,455 M409I probably benign Het
Ocstamp A G 2: 165,397,313 S318P possibly damaging Het
Olfr507 C T 7: 108,621,889 L26F probably benign Het
Phactr2 A G 10: 13,253,820 S235P probably damaging Het
Pom121l2 T C 13: 21,982,239 S227P probably benign Het
Sdf2 C T 11: 78,251,037 T66I probably damaging Het
Sptbn5 A G 2: 120,065,994 C729R probably damaging Het
Sys1 T C 2: 164,461,395 W10R probably damaging Het
Tfap4 A G 16: 4,551,999 I4T probably damaging Het
Thrb C A 14: 18,030,275 Q340K probably damaging Het
Tnc T C 4: 63,970,351 Y1735C probably damaging Het
Ubr1 A T 2: 120,895,066 probably null Het
Other mutations in Flcn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00573:Flcn APN 11 59795823 missense probably damaging 1.00
IGL01890:Flcn APN 11 59795170 missense probably benign 0.00
IGL02486:Flcn APN 11 59801043 nonsense probably null
IGL02933:Flcn APN 11 59803757 missense probably damaging 1.00
IGL02935:Flcn APN 11 59795236 missense possibly damaging 0.93
IGL03246:Flcn APN 11 59794110 missense possibly damaging 0.82
pansy UTSW 11 59792659 missense probably damaging 0.99
R0238:Flcn UTSW 11 59801076 missense probably benign 0.00
R0238:Flcn UTSW 11 59801076 missense probably benign 0.00
R0239:Flcn UTSW 11 59801076 missense probably benign 0.00
R0239:Flcn UTSW 11 59801076 missense probably benign 0.00
R0265:Flcn UTSW 11 59795809 nonsense probably null
R0534:Flcn UTSW 11 59794199 splice site probably benign
R0551:Flcn UTSW 11 59795748 critical splice donor site probably null
R1016:Flcn UTSW 11 59795865 critical splice acceptor site probably null
R1108:Flcn UTSW 11 59801200 missense possibly damaging 0.77
R2350:Flcn UTSW 11 59792659 missense probably damaging 0.99
R4158:Flcn UTSW 11 59801121 missense probably benign 0.26
R4367:Flcn UTSW 11 59803784 missense possibly damaging 0.90
R4612:Flcn UTSW 11 59792687 missense probably damaging 1.00
R4689:Flcn UTSW 11 59801044 missense possibly damaging 0.87
R5849:Flcn UTSW 11 59804760 missense probably damaging 0.99
R6007:Flcn UTSW 11 59792622 missense probably benign 0.08
R6433:Flcn UTSW 11 59801082 missense probably damaging 0.97
R6525:Flcn UTSW 11 59794172 missense possibly damaging 0.75
R7027:Flcn UTSW 11 59795806 missense probably damaging 1.00
R7632:Flcn UTSW 11 59795799 nonsense probably null
R8018:Flcn UTSW 11 59794122 missense probably damaging 0.97
X0002:Flcn UTSW 11 59804537 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CAGAGACATGTTCGTCAAGAATGG -3'
(R):5'- TCTGTAGATGTGCTGCCTGC -3'

Sequencing Primer
(F):5'- CTATTTAGACAGCTGGAGTCCACAG -3'
(R):5'- GCCTGCTTCTGCCTAAGAG -3'
Posted On2015-07-06