Incidental Mutation 'R4371:Tfap4'
ID326008
Institutional Source Beutler Lab
Gene Symbol Tfap4
Ensembl Gene ENSMUSG00000005718
Gene Nametranscription factor AP4
SynonymsAP-4, bHLHc41, Tcfap4
MMRRC Submission 041117-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.751) question?
Stock #R4371 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location4544661-4559854 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4551999 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 4 (I4T)
Ref Sequence ENSEMBL: ENSMUSP00000155303 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005862] [ENSMUST00000229956] [ENSMUST00000230875]
Predicted Effect possibly damaging
Transcript: ENSMUST00000005862
AA Change: I64T

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000005862
Gene: ENSMUSG00000005718
AA Change: I64T

DomainStartEndE-ValueType
low complexity region 41 52 N/A INTRINSIC
HLH 54 105 2.06e-16 SMART
coiled coil region 144 183 N/A INTRINSIC
low complexity region 193 210 N/A INTRINSIC
low complexity region 225 238 N/A INTRINSIC
low complexity region 306 327 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000229956
AA Change: I44T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000230875
AA Change: I4T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.9748 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Transcription factors of the basic helix-loop-helix-zipper (bHLH-ZIP) family contain a basic domain, which is used for DNA binding, and HLH and ZIP domains, which are used for oligomerization. Transcription factor AP4 activates both viral and cellular genes by binding to the symmetrical DNA sequence CAGCTG (Mermod et al., 1988 [PubMed 2833704]; Hu et al., 1990 [PubMed 2123466]).[supplied by OMIM, Jul 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial prenatal lethality and reduced suppression of Cd4 in double negative thymocytes. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alg11 C A 8: 22,068,079 A469E probably benign Het
Alox12b G A 11: 69,169,616 R666H possibly damaging Het
Atp9a T C 2: 168,649,615 T677A probably damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Bckdk C T 7: 127,906,419 A238V probably benign Het
Brpf3 C T 17: 28,836,620 A1181V probably damaging Het
C9 A G 15: 6,491,484 D470G probably damaging Het
Camsap2 A G 1: 136,287,963 F337L probably damaging Het
Cep152 G A 2: 125,613,047 R278W probably damaging Het
Cfb T C 17: 34,860,314 K287R probably damaging Het
Chfr G A 5: 110,136,168 R36H probably damaging Het
Cyp4f14 T C 17: 32,909,258 N261S probably benign Het
Drp2 A T X: 134,435,135 probably benign Het
Dzip3 A G 16: 48,943,455 probably null Het
Emb A T 13: 117,268,930 D296V probably damaging Het
Epha1 T C 6: 42,365,457 Y319C probably damaging Het
Flcn C T 11: 59,803,784 V121I possibly damaging Het
Glrp1 GTGCTGCTGCTGCTGCTGCTGCTGCTG GTGCTGCTGCTGCTGCTGCTGCTGCTGCTG 1: 88,503,275 probably benign Het
Gm6177 A T 1: 160,893,171 noncoding transcript Het
Hepacam2 A T 6: 3,486,988 V123E probably damaging Het
Iqsec1 A G 6: 90,694,606 S194P probably damaging Het
Kat6a T C 8: 22,911,929 I438T possibly damaging Het
Kcnmb2 A G 3: 32,156,102 probably null Het
Nbeal1 A T 1: 60,289,946 K2174N possibly damaging Het
Ncapg G A 5: 45,678,455 M409I probably benign Het
Ocstamp A G 2: 165,397,313 S318P possibly damaging Het
Olfr507 C T 7: 108,621,889 L26F probably benign Het
Phactr2 A G 10: 13,253,820 S235P probably damaging Het
Pom121l2 T C 13: 21,982,239 S227P probably benign Het
Sdf2 C T 11: 78,251,037 T66I probably damaging Het
Sptbn5 A G 2: 120,065,994 C729R probably damaging Het
Sys1 T C 2: 164,461,395 W10R probably damaging Het
Thrb C A 14: 18,030,275 Q340K probably damaging Het
Tnc T C 4: 63,970,351 Y1735C probably damaging Het
Ubr1 A T 2: 120,895,066 probably null Het
Other mutations in Tfap4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01155:Tfap4 APN 16 4547359 missense probably damaging 1.00
IGL01816:Tfap4 APN 16 4552092 missense probably damaging 0.98
IGL02947:Tfap4 APN 16 4551360 missense probably damaging 0.99
E0370:Tfap4 UTSW 16 4559470 missense possibly damaging 0.53
R1311:Tfap4 UTSW 16 4559426 critical splice donor site probably null
R1791:Tfap4 UTSW 16 4552069 missense possibly damaging 0.53
R4300:Tfap4 UTSW 16 4551360 missense probably damaging 0.99
R5945:Tfap4 UTSW 16 4545629 missense possibly damaging 0.53
R6219:Tfap4 UTSW 16 4547311 missense probably damaging 0.96
R6738:Tfap4 UTSW 16 4549447 missense probably damaging 0.99
R7678:Tfap4 UTSW 16 4551766 missense possibly damaging 0.53
R8496:Tfap4 UTSW 16 4551306 missense probably damaging 0.99
R8854:Tfap4 UTSW 16 4549374 missense probably benign 0.03
R8928:Tfap4 UTSW 16 4551354 missense probably damaging 0.99
X0065:Tfap4 UTSW 16 4547276 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- CTGCTGTCTGCTGGAGAATG -3'
(R):5'- GATCTGCCAGAGTTGGGATG -3'

Sequencing Primer
(F):5'- TCTGCTGGAGAATGGCTGCC -3'
(R):5'- TTGGGATGCCGGTTACAACC -3'
Posted On2015-07-06