Incidental Mutation 'R4372:Mtmr7'
ID326026
Institutional Source Beutler Lab
Gene Symbol Mtmr7
Ensembl Gene ENSMUSG00000039431
Gene Namemyotubularin related protein 7
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4372 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location40551095-40634797 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 40554345 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 516 (S516P)
Ref Sequence ENSEMBL: ENSMUSP00000043851 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048890] [ENSMUST00000048898] [ENSMUST00000098817] [ENSMUST00000173487] [ENSMUST00000174205]
Predicted Effect probably benign
Transcript: ENSMUST00000048890
SMART Domains Protein: ENSMUSP00000043367
Gene: ENSMUSG00000039431

DomainStartEndE-ValueType
Pfam:Myotub-related 108 450 4.9e-145 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000048898
AA Change: S516P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000043851
Gene: ENSMUSG00000039431
AA Change: S516P

DomainStartEndE-ValueType
Pfam:Myotub-related 109 448 1.6e-143 PFAM
coiled coil region 514 553 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000098817
SMART Domains Protein: ENSMUSP00000096415
Gene: ENSMUSG00000031600

DomainStartEndE-ValueType
low complexity region 6 22 N/A INTRINSIC
Blast:UBCc 29 128 6e-6 BLAST
low complexity region 155 164 N/A INTRINSIC
low complexity region 171 189 N/A INTRINSIC
Pfam:Mod_r 235 380 2.7e-39 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000173487
AA Change: S352P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000134281
Gene: ENSMUSG00000039431
AA Change: S352P

DomainStartEndE-ValueType
Pfam:Myotub-related 1 286 8.1e-125 PFAM
coiled coil region 350 383 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174205
SMART Domains Protein: ENSMUSP00000134731
Gene: ENSMUSG00000039431

DomainStartEndE-ValueType
Pfam:Myotub-related 108 450 7.2e-145 PFAM
Meta Mutation Damage Score 0.1198 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myotubularin family of tyrosine/dual-specificity phosphatases. The encoded protein is characterized by four distinct domains that are conserved among all members of the myotubularin family: the glucosyltransferase, Rab-like GTPase activator and myotubularins domain, the Rac-induced recruitment domain, the protein tyrosine phosphatases and dual-specificity phosphatases domain and the suppressor of variegation 3-9, enhancer-of-zeste, and trithorax interaction domain. This protein dephosphorylates the target substrates phosphatidylinositol 3-phosphate and inositol 1,3-bisphosphate. A pseudogene of this gene is found on chromosome 5. [provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810010H24Rik T C 11: 107,028,467 Y213H probably damaging Het
Alg5 T C 3: 54,738,955 probably null Het
Bend7 A T 2: 4,749,610 I175F probably damaging Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Dnah1 C T 14: 31,304,922 R715H probably damaging Het
Ipp T A 4: 116,515,363 D196E possibly damaging Het
Kcna5 A G 6: 126,533,357 *603Q probably null Het
Kdm3b A G 18: 34,827,444 T1161A probably benign Het
Kif20a A T 18: 34,629,478 Q468L probably damaging Het
Map7d2 A G X: 159,490,684 probably benign Het
Mdn1 A G 4: 32,743,809 E4015G probably benign Het
Mri1 A G 8: 84,253,925 V296A probably benign Het
Pcdhb10 T C 18: 37,413,313 S481P possibly damaging Het
Pklr C T 3: 89,145,523 R528* probably null Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Samsn1 G A 16: 75,859,456 T368I possibly damaging Het
Sema4d T C 13: 51,712,731 E241G probably damaging Het
Shank2 G A 7: 144,410,862 G729R probably benign Het
Slc35b2 G A 17: 45,566,429 V161M probably benign Het
Tmem55a C T 4: 14,912,463 R191C probably damaging Het
Vmn2r53 A G 7: 12,581,729 V721A probably damaging Het
Wdr17 T A 8: 54,639,895 Y1076F probably damaging Het
Wdr75 T C 1: 45,806,673 probably benign Het
Zhx2 A G 15: 57,823,301 S689G probably benign Het
Other mutations in Mtmr7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Mtmr7 APN 8 40597345 missense probably damaging 1.00
IGL01340:Mtmr7 APN 8 40597422 missense probably damaging 1.00
IGL01773:Mtmr7 APN 8 40581419 missense probably damaging 1.00
IGL02040:Mtmr7 APN 8 40560885 missense probably benign 0.01
IGL02195:Mtmr7 APN 8 40560905 missense probably damaging 0.96
IGL03394:Mtmr7 APN 8 40608929 missense probably damaging 0.97
R0116:Mtmr7 UTSW 8 40581405 splice site probably benign
R0379:Mtmr7 UTSW 8 40551601 missense probably damaging 1.00
R1443:Mtmr7 UTSW 8 40560882 missense probably damaging 1.00
R1763:Mtmr7 UTSW 8 40551811 missense probably benign
R4482:Mtmr7 UTSW 8 40554384 missense probably benign 0.32
R4502:Mtmr7 UTSW 8 40558162 missense possibly damaging 0.94
R4622:Mtmr7 UTSW 8 40581541 missense probably damaging 1.00
R4833:Mtmr7 UTSW 8 40590462 missense probably damaging 1.00
R4849:Mtmr7 UTSW 8 40608997 missense probably benign 0.00
R4991:Mtmr7 UTSW 8 40554345 missense probably damaging 1.00
R5424:Mtmr7 UTSW 8 40606830 missense probably benign
R5707:Mtmr7 UTSW 8 40558162 missense possibly damaging 0.94
R5929:Mtmr7 UTSW 8 40558358 critical splice acceptor site probably null
R5985:Mtmr7 UTSW 8 40551832 missense probably benign
R6013:Mtmr7 UTSW 8 40581528 missense probably damaging 1.00
R6249:Mtmr7 UTSW 8 40581482 missense probably damaging 1.00
R7052:Mtmr7 UTSW 8 40555833 missense possibly damaging 0.83
R7249:Mtmr7 UTSW 8 40590477 missense probably benign 0.11
R7538:Mtmr7 UTSW 8 40597384 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTAACACAGATGGCTTAGTGTTAG -3'
(R):5'- TCAAGGCTGTAACTTGCTTTTG -3'

Sequencing Primer
(F):5'- GACCCACTGACTTAAAAATGGCTTG -3'
(R):5'- GCTTTTGGTTATTAATATGTTGGGC -3'
Posted On2015-07-06