Incidental Mutation 'R4372:Zhx2'
ID326034
Institutional Source Beutler Lab
Gene Symbol Zhx2
Ensembl Gene ENSMUSG00000071757
Gene Namezinc fingers and homeoboxes 2
SynonymsAfr1, Raf, Afr-1
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.407) question?
Stock #R4372 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location57694665-57839832 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 57823301 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 689 (S689G)
Ref Sequence ENSEMBL: ENSMUSP00000094164 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096430]
Predicted Effect probably benign
Transcript: ENSMUST00000096430
AA Change: S689G

PolyPhen 2 Score 0.022 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000094164
Gene: ENSMUSG00000071757
AA Change: S689G

DomainStartEndE-ValueType
ZnF_C2H2 78 101 1.79e-2 SMART
ZnF_C2H2 110 133 1.99e0 SMART
low complexity region 191 209 N/A INTRINSIC
HOX 263 324 2.11e-3 SMART
HOX 439 501 4.94e-8 SMART
HOX 530 591 2.8e-7 SMART
HOX 628 690 3.09e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160990
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The members of the zinc fingers and homeoboxes gene family are nuclear homodimeric transcriptional repressors that interact with the A subunit of nuclear factor-Y (NF-YA) and contain two C2H2-type zinc fingers and five homeobox DNA-binding domains. This gene encodes member 2 of this gene family. In addition to forming homodimers, this protein heterodimerizes with member 1 of the zinc fingers and homeoboxes family. [provided by RefSeq, Jul 2008]
PHENOTYPE: Alpha-fetoprotein levels in plasma decline precipitously after birth. This gene regulates a difference in adult level and rate of neonatal decrease of AFP. The BALB/cJ substrain carries a genetic variant allele determining a slow rate of decline to adultlevel. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810010H24Rik T C 11: 107,028,467 Y213H probably damaging Het
Alg5 T C 3: 54,738,955 probably null Het
Bend7 A T 2: 4,749,610 I175F probably damaging Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Dnah1 C T 14: 31,304,922 R715H probably damaging Het
Ipp T A 4: 116,515,363 D196E possibly damaging Het
Kcna5 A G 6: 126,533,357 *603Q probably null Het
Kdm3b A G 18: 34,827,444 T1161A probably benign Het
Kif20a A T 18: 34,629,478 Q468L probably damaging Het
Map7d2 A G X: 159,490,684 probably benign Het
Mdn1 A G 4: 32,743,809 E4015G probably benign Het
Mri1 A G 8: 84,253,925 V296A probably benign Het
Mtmr7 A G 8: 40,554,345 S516P probably damaging Het
Pcdhb10 T C 18: 37,413,313 S481P possibly damaging Het
Pklr C T 3: 89,145,523 R528* probably null Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Samsn1 G A 16: 75,859,456 T368I possibly damaging Het
Sema4d T C 13: 51,712,731 E241G probably damaging Het
Shank2 G A 7: 144,410,862 G729R probably benign Het
Slc35b2 G A 17: 45,566,429 V161M probably benign Het
Tmem55a C T 4: 14,912,463 R191C probably damaging Het
Vmn2r53 A G 7: 12,581,729 V721A probably damaging Het
Wdr17 T A 8: 54,639,895 Y1076F probably damaging Het
Wdr75 T C 1: 45,806,673 probably benign Het
Other mutations in Zhx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Zhx2 APN 15 57822870 missense probably damaging 1.00
IGL00694:Zhx2 APN 15 57821760 missense probably benign
IGL02407:Zhx2 APN 15 57823406 missense probably benign 0.00
IGL02456:Zhx2 APN 15 57823639 missense possibly damaging 0.72
IGL02737:Zhx2 APN 15 57822267 missense probably damaging 1.00
IGL03050:Zhx2 UTSW 15 57822833 missense possibly damaging 0.90
R0010:Zhx2 UTSW 15 57821274 missense possibly damaging 0.92
R0105:Zhx2 UTSW 15 57822695 missense probably damaging 1.00
R0420:Zhx2 UTSW 15 57821840 missense probably damaging 1.00
R0799:Zhx2 UTSW 15 57821313 missense probably benign
R0800:Zhx2 UTSW 15 57822728 missense probably damaging 1.00
R2273:Zhx2 UTSW 15 57823169 missense probably benign 0.30
R2497:Zhx2 UTSW 15 57823155 missense possibly damaging 0.48
R4198:Zhx2 UTSW 15 57821729 missense probably benign
R4992:Zhx2 UTSW 15 57823587 missense probably damaging 0.96
R4994:Zhx2 UTSW 15 57821359 missense probably benign 0.03
R5085:Zhx2 UTSW 15 57822693 missense probably damaging 1.00
R5141:Zhx2 UTSW 15 57821786 missense probably benign 0.00
R5470:Zhx2 UTSW 15 57823074 missense possibly damaging 0.76
R5659:Zhx2 UTSW 15 57822308 missense probably benign
R5710:Zhx2 UTSW 15 57821470 nonsense probably null
R6171:Zhx2 UTSW 15 57823206 missense probably damaging 1.00
R7181:Zhx2 UTSW 15 57823350 missense probably benign
R7215:Zhx2 UTSW 15 57823643 missense probably benign
R7273:Zhx2 UTSW 15 57823428 missense probably benign 0.09
R7575:Zhx2 UTSW 15 57823262 missense probably damaging 1.00
R7662:Zhx2 UTSW 15 57822176 missense probably damaging 1.00
R7883:Zhx2 UTSW 15 57821874 missense possibly damaging 0.67
R7966:Zhx2 UTSW 15 57821874 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- TAGCTGGTTCTTTGCCCAG -3'
(R):5'- TCCTTGGTTGGATCACCACC -3'

Sequencing Primer
(F):5'- CAGTCCTTCATCAGCAATTGTAC -3'
(R):5'- ACTTTCATCCTCGGGACCAG -3'
Posted On2015-07-06