Incidental Mutation 'R4372:Samsn1'
ID326035
Institutional Source Beutler Lab
Gene Symbol Samsn1
Ensembl Gene ENSMUSG00000022876
Gene NameSAM domain, SH3 domain and nuclear localization signals, 1
Synonyms4930571B16Rik, Hacs1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4372 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location75858793-76022281 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 75859456 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 368 (T368I)
Ref Sequence ENSEMBL: ENSMUSP00000109877 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114239] [ENSMUST00000114240]
PDB Structure
Solution structure of the Sterile Alpha Motif (SAM) domain of mouse SAMSN1 [SOLUTION NMR]
Predicted Effect possibly damaging
Transcript: ENSMUST00000114239
AA Change: T368I

PolyPhen 2 Score 0.804 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000109877
Gene: ENSMUSG00000022876
AA Change: T368I

DomainStartEndE-ValueType
Pfam:SLY 17 164 4.7e-57 PFAM
SH3 166 223 8.78e-4 SMART
SAM 238 305 7.6e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000114240
SMART Domains Protein: ENSMUSP00000109878
Gene: ENSMUSG00000022876

DomainStartEndE-ValueType
low complexity region 69 80 N/A INTRINSIC
Pfam:SLY 146 293 1.1e-55 PFAM
SH3 295 352 8.78e-4 SMART
SAM 367 434 7.6e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226794
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SAMSN1 is a member of a novel gene family of putative adaptors and scaffold proteins containing SH3 and SAM (sterile alpha motif) domains (Claudio et al., 2001 [PubMed 11536050]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit enhanced adaptive immunity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810010H24Rik T C 11: 107,028,467 Y213H probably damaging Het
Alg5 T C 3: 54,738,955 probably null Het
Bend7 A T 2: 4,749,610 I175F probably damaging Het
Ddx41 G A 13: 55,534,480 R205W possibly damaging Het
Dnah1 C T 14: 31,304,922 R715H probably damaging Het
Ipp T A 4: 116,515,363 D196E possibly damaging Het
Kcna5 A G 6: 126,533,357 *603Q probably null Het
Kdm3b A G 18: 34,827,444 T1161A probably benign Het
Kif20a A T 18: 34,629,478 Q468L probably damaging Het
Map7d2 A G X: 159,490,684 probably benign Het
Mdn1 A G 4: 32,743,809 E4015G probably benign Het
Mri1 A G 8: 84,253,925 V296A probably benign Het
Mtmr7 A G 8: 40,554,345 S516P probably damaging Het
Pcdhb10 T C 18: 37,413,313 S481P possibly damaging Het
Pklr C T 3: 89,145,523 R528* probably null Het
Rin2 C T 2: 145,860,446 T354I probably benign Het
Sema4d T C 13: 51,712,731 E241G probably damaging Het
Shank2 G A 7: 144,410,862 G729R probably benign Het
Slc35b2 G A 17: 45,566,429 V161M probably benign Het
Tmem55a C T 4: 14,912,463 R191C probably damaging Het
Vmn2r53 A G 7: 12,581,729 V721A probably damaging Het
Wdr17 T A 8: 54,639,895 Y1076F probably damaging Het
Wdr75 T C 1: 45,806,673 probably benign Het
Zhx2 A G 15: 57,823,301 S689G probably benign Het
Other mutations in Samsn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00904:Samsn1 APN 16 75909120 splice site probably benign
IGL02220:Samsn1 APN 16 75883875 critical splice donor site probably null
R0455:Samsn1 UTSW 16 75945225 unclassified noncoding transcript
R1136:Samsn1 UTSW 16 75873520 missense probably null 0.00
R1140:Samsn1 UTSW 16 75888742 missense possibly damaging 0.73
R1180:Samsn1 UTSW 16 75873648 missense probably damaging 1.00
R1772:Samsn1 UTSW 16 75870775 missense probably benign 0.01
R1968:Samsn1 UTSW 16 75945573 exon noncoding transcript
R4035:Samsn1 UTSW 16 75909185 start codon destroyed probably null 0.99
R4725:Samsn1 UTSW 16 75945329 unclassified noncoding transcript
R4779:Samsn1 UTSW 16 75947289 exon noncoding transcript
R4795:Samsn1 UTSW 16 75883845 intron probably benign
R4899:Samsn1 UTSW 16 75879103 missense probably damaging 1.00
R4905:Samsn1 UTSW 16 75876465 missense possibly damaging 0.94
R5050:Samsn1 UTSW 16 75888757 missense probably benign
R5789:Samsn1 UTSW 16 75876448 missense probably damaging 1.00
R6005:Samsn1 UTSW 16 75873514 missense probably benign 0.03
R6190:Samsn1 UTSW 16 75870915 missense probably damaging 1.00
R6218:Samsn1 UTSW 16 75945274 unclassified noncoding transcript
R6630:Samsn1 UTSW 16 75879204 missense probably benign 0.00
R7086:Samsn1 UTSW 16 75870906 missense probably benign 0.00
R8289:Samsn1 UTSW 16 75888796 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CATGGGCTTGCATCATGTC -3'
(R):5'- AAAAGGAATCCGTGCCTCTATC -3'

Sequencing Primer
(F):5'- CAGGCAGGTAAACTTTAACACATAG -3'
(R):5'- TCCTCAAACCCAGACATCTTGAGTG -3'
Posted On2015-07-06