Mutagenetix > Incidental Mutations

Incidental Mutation 'R4373:Stat4'

326041

Institutional Source

Beutler Lab

Gene Symbol

Stat4

Ensembl Gene

ENSMUSG00000062939

Gene Name

signal transducer and activator of transcription 4

Synonyms

MMRRC Submission

041675-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.398) question?

Stock #

R4373 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

51987148-52107189 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 52071941 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000130713 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027277] [ENSMUST00000027277] [ENSMUST00000168302] [ENSMUST00000168302]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000027277

SMART Domains

Protein: ENSMUSP00000027277
Gene: ENSMUSG00000062939

Domain	Start	End	E-Value	Type
STAT_int	2	122	3.73e-60	SMART
Pfam:STAT_alpha	140	314	2.2e-54	PFAM
Pfam:STAT_bind	316	562	4.7e-76	PFAM
SH2	571	681	9.07e-1	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000027277

SMART Domains

Protein: ENSMUSP00000027277
Gene: ENSMUSG00000062939

Domain	Start	End	E-Value	Type
STAT_int	2	122	3.73e-60	SMART
Pfam:STAT_alpha	140	314	2.2e-54	PFAM
Pfam:STAT_bind	316	562	4.7e-76	PFAM
SH2	571	681	9.07e-1	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000168302

SMART Domains

Protein: ENSMUSP00000130713
Gene: ENSMUSG00000062939

Domain	Start	End	E-Value	Type
STAT_int	2	122	3.73e-60	SMART
Pfam:STAT_alpha	137	314	8.2e-66	PFAM
Pfam:STAT_bind	316	563	3.3e-114	PFAM
SH2	571	681	9.07e-1	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000168302

SMART Domains

Protein: ENSMUSP00000130713
Gene: ENSMUSG00000062939

Domain	Start	End	E-Value	Type
STAT_int	2	122	3.73e-60	SMART
Pfam:STAT_alpha	137	314	8.2e-66	PFAM
Pfam:STAT_bind	316	563	3.3e-114	PFAM
SH2	571	681	9.07e-1	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000187053

Meta Mutation Damage Score

0.9490

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.9%

Validation Efficiency

98% (54/55)

MGI Phenotype

FUNCTION: The protein encoded by this gene is a member of the STAT family of transcription factors. In response to cytokines and growth factors, STAT family members are phosphorylated by the receptor associated kinases, and then form homo- or heterodimers that translocate to the cell nucleus where they act as transcription activators. Homozygous knockout mice for this gene exhibit reduced inflammation and cytokine production in response to immune challenge. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
PHENOTYPE: Homozygous inactivation of this gene leads to altered cytokine production of T-cells, impaired IL-12 responses, enhanced Th2 cell development, decreased susceptibility to autoimmune diabetes, altered NK cell responses during viral infection, and increased susceptibility to Salmonella infection. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	T	11: 23,615,265		probably null	Het
3632451O06Rik	T	A	14: 49,770,436	T527S	probably damaging	Het
Adck5	A	G	15: 76,594,335		probably benign	Het
Akr1b3	A	C	6: 34,304,267		probably benign	Het
Asns	A	T	6: 7,677,978	S367T	probably damaging	Het
BC034090	T	C	1: 155,226,158	N120S	probably benign	Het
Bub1	A	T	2: 127,805,236		probably benign	Het
Csf1	T	A	3: 107,756,739	T38S	probably damaging	Het
Ctsz	T	C	2: 174,428,585	E268G	possibly damaging	Het
Dach1	G	A	14: 97,827,750	T685I	possibly damaging	Het
Dclre1a	A	G	19: 56,545,442	L240S	probably benign	Het
Ercc1	G	A	7: 19,347,132		probably benign	Het
Esam	C	T	9: 37,534,196	T71I	probably benign	Het
Espl1	A	G	15: 102,312,989	I944V	probably damaging	Het
Gde1	A	G	7: 118,698,558	L35P	possibly damaging	Het
Gm10382	A	G	5: 125,389,583		probably benign	Het
H2-M10.6	T	C	17: 36,813,066	Y141H	probably damaging	Het
Hk1	C	A	10: 62,315,540	K10N	probably damaging	Het
Lamc3	A	G	2: 31,898,232	K135E	probably damaging	Het
Lrtm2	A	G	6: 119,320,528	F184S	probably damaging	Het
March11	A	G	15: 26,309,446	E62G	probably damaging	Het
Mtcl1	T	A	17: 66,380,079	T611S	probably benign	Het
Myc	A	T	15: 61,989,664	H373L	probably damaging	Het
Myh6	T	A	14: 54,962,108	I249F	probably damaging	Het
Naaa	T	C	5: 92,278,143		probably benign	Het
Nfib	A	G	4: 82,323,658	V432A	probably damaging	Het
Nmt1	A	G	11: 103,043,200	K55R	probably damaging	Het
Olfr1228	T	C	2: 89,249,245	R150G	possibly damaging	Het
Opa3	C	T	7: 19,244,774	R55W	probably damaging	Het
Pfn4	T	A	12: 4,770,182	D10E	probably damaging	Het
Pld5	T	A	1: 176,140,017	I91F	probably damaging	Het
Plec	A	C	15: 76,183,117	S1350A	probably damaging	Het
Polq	G	T	16: 37,013,181	V79F	probably damaging	Het
Ppp1r16b	T	C	2: 158,761,765	Y537H	probably damaging	Het
Prdm8	T	C	5: 98,186,508	S645P	probably damaging	Het
Rgs1	T	C	1: 144,247,906	T94A	probably benign	Het
Rpl11	G	A	4: 136,051,143		probably benign	Het
Scamp3	G	A	3: 89,181,927		probably null	Het
Sgsm1	TTTTATATT	TTT	5: 113,258,123		probably benign	Het
Sirpb1b	A	T	3: 15,548,761	I87K	probably damaging	Het
Slc14a2	G	A	18: 78,207,068	R62C	probably damaging	Het
Tex9	A	T	9: 72,480,595		probably null	Het
Tsku	T	C	7: 98,352,831	T98A	probably benign	Het
Ttc23l	CT	CTTGGATT	15: 10,537,562		probably benign	Het
Ttc23l	G	A	15: 10,537,566	S206L	probably benign	Het
Vmn2r116	A	C	17: 23,401,421	I710L	probably benign	Het
Vmn2r16	A	T	5: 109,363,801	I625F	probably damaging	Het
Xpo4	G	A	14: 57,591,022	Q794*	probably null	Het
Zfp112	T	A	7: 24,125,048	I147N	probably damaging	Het
Zmiz1	T	C	14: 25,636,010	S140P	probably damaging	Het

Other mutations in Stat4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00236:Stat4	APN	1	52102878	missense	probably damaging	1.00
IGL00482:Stat4	APN	1	52074697	missense	probably benign	0.05
IGL01395:Stat4	APN	1	52011874	missense	probably damaging	1.00
IGL01533:Stat4	APN	1	52098419	missense	probably damaging	1.00
IGL01943:Stat4	APN	1	52096855	missense	possibly damaging	0.94
IGL02114:Stat4	APN	1	52102865	missense	probably damaging	1.00
IGL02151:Stat4	APN	1	52013870	missense	probably damaging	0.99
IGL02601:Stat4	APN	1	52098415	missense	probably damaging	1.00
R0016:Stat4	UTSW	1	52068780	missense	probably benign	0.01
R0243:Stat4	UTSW	1	52011857	missense	probably benign	0.22
R0329:Stat4	UTSW	1	52090870	intron	probably benign
R0973:Stat4	UTSW	1	52096820	missense	probably damaging	0.99
R1144:Stat4	UTSW	1	52084129	splice site	probably benign
R1187:Stat4	UTSW	1	52076677	missense	probably damaging	1.00
R1331:Stat4	UTSW	1	52013927	missense	probably benign	0.20
R1401:Stat4	UTSW	1	52071947	splice site	probably benign
R1529:Stat4	UTSW	1	52011793	missense	probably damaging	1.00
R1711:Stat4	UTSW	1	52106925	missense	probably damaging	1.00
R2213:Stat4	UTSW	1	52013855	missense	probably damaging	0.98
R3003:Stat4	UTSW	1	52102986	missense	probably damaging	1.00
R3683:Stat4	UTSW	1	52013822	missense	possibly damaging	0.89
R3789:Stat4	UTSW	1	52011796	missense	probably benign	0.07
R3919:Stat4	UTSW	1	52096822	missense	possibly damaging	0.62
R4320:Stat4	UTSW	1	52074707	missense	probably benign
R5024:Stat4	UTSW	1	52082570	missense	possibly damaging	0.80
R5103:Stat4	UTSW	1	52071895	missense	probably damaging	0.97
R5206:Stat4	UTSW	1	52105236	missense	probably damaging	0.99
R5944:Stat4	UTSW	1	52074739	missense	probably damaging	1.00
R5961:Stat4	UTSW	1	52065384	missense	possibly damaging	0.50
R6001:Stat4	UTSW	1	52096867	missense	probably damaging	0.96
R6161:Stat4	UTSW	1	52074677	missense	possibly damaging	0.94
R6262:Stat4	UTSW	1	52102201	missense	probably null	1.00
R6701:Stat4	UTSW	1	52102974	missense	probably damaging	1.00
R6767:Stat4	UTSW	1	52076583	missense	probably benign	0.00
R6989:Stat4	UTSW	1	52068815	missense	probably benign	0.09
R7507:Stat4	UTSW	1	52078574	missense	probably damaging	1.00
R7539:Stat4	UTSW	1	52071709	splice site	probably null
R7546:Stat4	UTSW	1	52098463	missense	probably damaging	0.98
R7616:Stat4	UTSW	1	52013878	nonsense	probably null
R7751:Stat4	UTSW	1	52082552	missense	possibly damaging	0.73
R8052:Stat4	UTSW	1	52079773	missense	probably damaging	1.00
R8311:Stat4	UTSW	1	52102916	missense	probably damaging	1.00
R8419:Stat4	UTSW	1	52098478	missense	possibly damaging	0.89
R8679:Stat4	UTSW	1	52079832	missense	probably null	1.00
R8699:Stat4	UTSW	1	52071937	missense	probably benign
R8738:Stat4	UTSW	1	52076552	missense	possibly damaging	0.95
R8921:Stat4	UTSW	1	52105733	missense	probably benign	0.39
R9013:Stat4	UTSW	1	52011798	missense	probably benign	0.00
R9237:Stat4	UTSW	1	52106914	missense	probably benign
Z1177:Stat4	UTSW	1	52084099	nonsense	probably null
Z1177:Stat4	UTSW	1	52098485	missense	probably null	1.00

Predicted Primers

PCR Primer
(F):5'- GCTGTTGGAGATTGGCTACC -3'
(R):5'- GCAGTGGGCATCATTTCTTATG -3'

Sequencing Primer
(F):5'- TCTATGGCAGGCTTAAGC -3'
(R):5'- TGGGCATCATTTCTTATGTAACTTG -3'

Posted On

2015-07-06