Incidental Mutation 'R4373:Rgs1'
ID326042
Institutional Source Beutler Lab
Gene Symbol Rgs1
Ensembl Gene ENSMUSG00000026358
Gene Nameregulator of G-protein signaling 1
SynonymsBL34
MMRRC Submission 041675-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.139) question?
Stock #R4373 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location144242296-144249242 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 144247906 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 94 (T94A)
Ref Sequence ENSEMBL: ENSMUSP00000140624 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167317] [ENSMUST00000169409] [ENSMUST00000172388] [ENSMUST00000185714] [ENSMUST00000189061]
Predicted Effect probably benign
Transcript: ENSMUST00000167317
Predicted Effect probably benign
Transcript: ENSMUST00000167812
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169042
Predicted Effect probably benign
Transcript: ENSMUST00000169409
Predicted Effect noncoding transcript
Transcript: ENSMUST00000170870
Predicted Effect probably benign
Transcript: ENSMUST00000172388
SMART Domains Protein: ENSMUSP00000130339
Gene: ENSMUSG00000026358

DomainStartEndE-ValueType
RGS 85 200 5.59e-49 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000185714
AA Change: T67A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000140902
Gene: ENSMUSG00000026358
AA Change: T67A

DomainStartEndE-ValueType
RGS 58 128 2.8e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189061
AA Change: T94A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000140624
Gene: ENSMUSG00000026358
AA Change: T94A

DomainStartEndE-ValueType
RGS 85 200 5.59e-49 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000189916
Meta Mutation Damage Score 0.0641 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the regulator of G-protein signalling family. This protein is located on the cytosolic side of the plasma membrane and contains a conserved, 120 amino acid motif called the RGS domain. The protein attenuates the signalling activity of G-proteins by binding to activated, GTP-bound G alpha subunits and acting as a GTPase activating protein (GAP), increasing the rate of conversion of the GTP to GDP. This hydrolysis allows the G alpha subunits to bind G beta/gamma subunit heterodimers, forming inactive G-protein heterotrimers, thereby terminating the signal. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice display increased splenic B cell germinal centers, increased chemotactic responses in B cells and immature dendritic cells, and decreased antibody secreting cell numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A T 11: 23,615,265 probably null Het
3632451O06Rik T A 14: 49,770,436 T527S probably damaging Het
Adck5 A G 15: 76,594,335 probably benign Het
Akr1b3 A C 6: 34,304,267 probably benign Het
Asns A T 6: 7,677,978 S367T probably damaging Het
BC034090 T C 1: 155,226,158 N120S probably benign Het
Bub1 A T 2: 127,805,236 probably benign Het
Csf1 T A 3: 107,756,739 T38S probably damaging Het
Ctsz T C 2: 174,428,585 E268G possibly damaging Het
Dach1 G A 14: 97,827,750 T685I possibly damaging Het
Dclre1a A G 19: 56,545,442 L240S probably benign Het
Ercc1 G A 7: 19,347,132 probably benign Het
Esam C T 9: 37,534,196 T71I probably benign Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Gde1 A G 7: 118,698,558 L35P possibly damaging Het
Gm10382 A G 5: 125,389,583 probably benign Het
H2-M10.6 T C 17: 36,813,066 Y141H probably damaging Het
Hk1 C A 10: 62,315,540 K10N probably damaging Het
Lamc3 A G 2: 31,898,232 K135E probably damaging Het
Lrtm2 A G 6: 119,320,528 F184S probably damaging Het
March11 A G 15: 26,309,446 E62G probably damaging Het
Mtcl1 T A 17: 66,380,079 T611S probably benign Het
Myc A T 15: 61,989,664 H373L probably damaging Het
Myh6 T A 14: 54,962,108 I249F probably damaging Het
Naaa T C 5: 92,278,143 probably benign Het
Nfib A G 4: 82,323,658 V432A probably damaging Het
Nmt1 A G 11: 103,043,200 K55R probably damaging Het
Olfr1228 T C 2: 89,249,245 R150G possibly damaging Het
Opa3 C T 7: 19,244,774 R55W probably damaging Het
Pfn4 T A 12: 4,770,182 D10E probably damaging Het
Pld5 T A 1: 176,140,017 I91F probably damaging Het
Plec A C 15: 76,183,117 S1350A probably damaging Het
Polq G T 16: 37,013,181 V79F probably damaging Het
Ppp1r16b T C 2: 158,761,765 Y537H probably damaging Het
Prdm8 T C 5: 98,186,508 S645P probably damaging Het
Rpl11 G A 4: 136,051,143 probably benign Het
Scamp3 G A 3: 89,181,927 probably null Het
Sgsm1 TTTTATATT TTT 5: 113,258,123 probably benign Het
Sirpb1b A T 3: 15,548,761 I87K probably damaging Het
Slc14a2 G A 18: 78,207,068 R62C probably damaging Het
Stat4 T C 1: 52,071,941 probably null Het
Tex9 A T 9: 72,480,595 probably null Het
Tsku T C 7: 98,352,831 T98A probably benign Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Vmn2r116 A C 17: 23,401,421 I710L probably benign Het
Vmn2r16 A T 5: 109,363,801 I625F probably damaging Het
Xpo4 G A 14: 57,591,022 Q794* probably null Het
Zfp112 T A 7: 24,125,048 I147N probably damaging Het
Zmiz1 T C 14: 25,636,010 S140P probably damaging Het
Other mutations in Rgs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01373:Rgs1 APN 1 144245378 missense probably damaging 1.00
R0106:Rgs1 UTSW 1 144248549 missense probably benign 0.31
R0106:Rgs1 UTSW 1 144248549 missense probably benign 0.31
R0149:Rgs1 UTSW 1 144249087 start gained probably benign
R0295:Rgs1 UTSW 1 144245486 missense probably damaging 1.00
R0833:Rgs1 UTSW 1 144247933 missense probably damaging 1.00
R0836:Rgs1 UTSW 1 144247933 missense probably damaging 1.00
R1585:Rgs1 UTSW 1 144245489 critical splice acceptor site probably null
R4375:Rgs1 UTSW 1 144247906 missense probably benign 0.00
R4769:Rgs1 UTSW 1 144247929 missense probably damaging 1.00
R4961:Rgs1 UTSW 1 144248571 splice site probably null
R4992:Rgs1 UTSW 1 144246322 missense probably damaging 1.00
R5427:Rgs1 UTSW 1 144246280 nonsense probably null
R5614:Rgs1 UTSW 1 144246257 missense probably benign 0.18
R5743:Rgs1 UTSW 1 144245372 missense probably damaging 1.00
R7315:Rgs1 UTSW 1 144248899 critical splice donor site probably null
R7491:Rgs1 UTSW 1 144245396 missense probably damaging 1.00
R7633:Rgs1 UTSW 1 144248477 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACACATGTAACTGTTTTGGCAG -3'
(R):5'- TAGCCCATATTAGAGCCAATGAAC -3'

Sequencing Primer
(F):5'- TTTGGCAGATTTGTCTAAAGGAC -3'
(R):5'- ATGTCCACATCAGTTTTCTATTTGTG -3'
Posted On2015-07-06