Incidental Mutation 'R4373:Pld5'
ID326044
Institutional Source Beutler Lab
Gene Symbol Pld5
Ensembl Gene ENSMUSG00000055214
Gene Namephospholipase D family, member 5
SynonymsB230365F16Rik
MMRRC Submission 041675-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4373 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location175962306-176275312 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 176140017 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 91 (I91F)
Ref Sequence ENSEMBL: ENSMUSP00000069326 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065967] [ENSMUST00000111167] [ENSMUST00000125404]
Predicted Effect probably damaging
Transcript: ENSMUST00000065967
AA Change: I91F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000069326
Gene: ENSMUSG00000055214
AA Change: I91F

DomainStartEndE-ValueType
transmembrane domain 68 90 N/A INTRINSIC
PLDc 215 242 3.62e-3 SMART
Pfam:PLDc_3 245 421 2e-101 PFAM
PLDc 434 460 6.11e0 SMART
low complexity region 511 521 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000111167
AA Change: I29F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106797
Gene: ENSMUSG00000055214
AA Change: I29F

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
PLDc 153 180 3.62e-3 SMART
PLDc 372 398 6.11e0 SMART
low complexity region 449 459 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000125404
AA Change: I91F

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000121428
Gene: ENSMUSG00000055214
AA Change: I91F

DomainStartEndE-ValueType
transmembrane domain 69 91 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144340
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156184
Meta Mutation Damage Score 0.0845 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 98% (54/55)
MGI Phenotype PHENOTYPE: No abnormal phenotype was observed in a high-throughput screen, nor in a pathology assessment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A T 11: 23,615,265 probably null Het
3632451O06Rik T A 14: 49,770,436 T527S probably damaging Het
Adck5 A G 15: 76,594,335 probably benign Het
Akr1b3 A C 6: 34,304,267 probably benign Het
Asns A T 6: 7,677,978 S367T probably damaging Het
BC034090 T C 1: 155,226,158 N120S probably benign Het
Bub1 A T 2: 127,805,236 probably benign Het
Csf1 T A 3: 107,756,739 T38S probably damaging Het
Ctsz T C 2: 174,428,585 E268G possibly damaging Het
Dach1 G A 14: 97,827,750 T685I possibly damaging Het
Dclre1a A G 19: 56,545,442 L240S probably benign Het
Ercc1 G A 7: 19,347,132 probably benign Het
Esam C T 9: 37,534,196 T71I probably benign Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Gde1 A G 7: 118,698,558 L35P possibly damaging Het
Gm10382 A G 5: 125,389,583 probably benign Het
H2-M10.6 T C 17: 36,813,066 Y141H probably damaging Het
Hk1 C A 10: 62,315,540 K10N probably damaging Het
Lamc3 A G 2: 31,898,232 K135E probably damaging Het
Lrtm2 A G 6: 119,320,528 F184S probably damaging Het
March11 A G 15: 26,309,446 E62G probably damaging Het
Mtcl1 T A 17: 66,380,079 T611S probably benign Het
Myc A T 15: 61,989,664 H373L probably damaging Het
Myh6 T A 14: 54,962,108 I249F probably damaging Het
Naaa T C 5: 92,278,143 probably benign Het
Nfib A G 4: 82,323,658 V432A probably damaging Het
Nmt1 A G 11: 103,043,200 K55R probably damaging Het
Olfr1228 T C 2: 89,249,245 R150G possibly damaging Het
Opa3 C T 7: 19,244,774 R55W probably damaging Het
Pfn4 T A 12: 4,770,182 D10E probably damaging Het
Plec A C 15: 76,183,117 S1350A probably damaging Het
Polq G T 16: 37,013,181 V79F probably damaging Het
Ppp1r16b T C 2: 158,761,765 Y537H probably damaging Het
Prdm8 T C 5: 98,186,508 S645P probably damaging Het
Rgs1 T C 1: 144,247,906 T94A probably benign Het
Rpl11 G A 4: 136,051,143 probably benign Het
Scamp3 G A 3: 89,181,927 probably null Het
Sgsm1 TTTTATATT TTT 5: 113,258,123 probably benign Het
Sirpb1b A T 3: 15,548,761 I87K probably damaging Het
Slc14a2 G A 18: 78,207,068 R62C probably damaging Het
Stat4 T C 1: 52,071,941 probably null Het
Tex9 A T 9: 72,480,595 probably null Het
Tsku T C 7: 98,352,831 T98A probably benign Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Vmn2r116 A C 17: 23,401,421 I710L probably benign Het
Vmn2r16 A T 5: 109,363,801 I625F probably damaging Het
Xpo4 G A 14: 57,591,022 Q794* probably null Het
Zfp112 T A 7: 24,125,048 I147N probably damaging Het
Zmiz1 T C 14: 25,636,010 S140P probably damaging Het
Other mutations in Pld5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00815:Pld5 APN 1 176140019 missense probably damaging 1.00
IGL00949:Pld5 APN 1 175975473 missense probably damaging 1.00
IGL01067:Pld5 APN 1 176274879 utr 5 prime probably benign
IGL02174:Pld5 APN 1 176274744 missense possibly damaging 0.86
IGL02380:Pld5 APN 1 176140044 missense probably damaging 0.97
IGL02879:Pld5 APN 1 175970591 missense probably damaging 1.00
R0087:Pld5 UTSW 1 175984459 missense probably damaging 0.98
R0135:Pld5 UTSW 1 175970589 missense probably damaging 1.00
R0144:Pld5 UTSW 1 175970541 missense probably benign 0.00
R0362:Pld5 UTSW 1 175975580 nonsense probably null
R0453:Pld5 UTSW 1 176089956 missense possibly damaging 0.75
R0454:Pld5 UTSW 1 176274729 missense probably benign 0.00
R0722:Pld5 UTSW 1 175975515 missense probably benign 0.34
R0751:Pld5 UTSW 1 176044896 missense probably damaging 0.98
R0785:Pld5 UTSW 1 175975452 splice site probably benign
R1184:Pld5 UTSW 1 176044896 missense probably damaging 0.98
R1501:Pld5 UTSW 1 175975521 missense probably benign 0.36
R1644:Pld5 UTSW 1 175975626 missense possibly damaging 0.86
R2012:Pld5 UTSW 1 175964013 missense probably benign 0.27
R2426:Pld5 UTSW 1 175963976 missense probably benign
R3508:Pld5 UTSW 1 175994037 missense probably damaging 1.00
R3917:Pld5 UTSW 1 175963938 missense probably benign 0.00
R4207:Pld5 UTSW 1 175993875 missense probably damaging 1.00
R4828:Pld5 UTSW 1 176274867 missense probably benign 0.06
R4831:Pld5 UTSW 1 176274884 utr 5 prime probably benign
R5861:Pld5 UTSW 1 176090005 missense probably damaging 1.00
R6182:Pld5 UTSW 1 176044854 missense probably benign 0.35
R6191:Pld5 UTSW 1 175970534 missense probably benign 0.04
R6246:Pld5 UTSW 1 175963909 nonsense probably null
R6737:Pld5 UTSW 1 176090022 missense probably damaging 1.00
R7082:Pld5 UTSW 1 176089876 missense probably benign 0.21
R7164:Pld5 UTSW 1 176213621 start codon destroyed probably null 0.00
R7237:Pld5 UTSW 1 176274735 missense possibly damaging 0.79
R7635:Pld5 UTSW 1 175993850 critical splice donor site probably null
R7805:Pld5 UTSW 1 176044914 missense probably damaging 1.00
R8038:Pld5 UTSW 1 176044897 missense probably benign 0.19
X0004:Pld5 UTSW 1 176261522 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CTCGGTTAAGTCCTGCTGAAA -3'
(R):5'- CTGAAACTGGACTAGAATAATTGCTTA -3'

Sequencing Primer
(F):5'- TGAAAGCAGATCTGAGCAGACATCTC -3'
(R):5'- GGGTCCCTTCAGCAAAATTG -3'
Posted On2015-07-06