Mutagenetix > Incidental Mutation

Incidental Mutation 'R4373:Bub1'

326046

Institutional Source

Beutler Lab

Gene Symbol

Bub1

Ensembl Gene

ENSMUSG00000027379

Gene Name

BUB1, mitotic checkpoint serine/threonine kinase

Synonyms

D2Xrf87, Bub1a

MMRRC Submission

041675-MU

Accession Numbers

Genbank: NM_009772; MGI: 1100510

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4373 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

127801122-127831865 bp(-) (GRCm38)

Type of Mutation

intron

DNA Base Change (assembly)

A to T at 127805236 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000028858 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028858]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000028858

SMART Domains

Protein: ENSMUSP00000028858
Gene: ENSMUSG00000027379

Domain	Start	End	E-Value	Type
Mad3_BUB1_I	4	126	7.41e-46	SMART
low complexity region	216	225	N/A	INTRINSIC
low complexity region	372	385	N/A	INTRINSIC
Pfam:Pkinase_Tyr	762	1011	9.3e-10	PFAM
Pfam:Pkinase	762	1037	1.7e-21	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138624

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153048

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.9%

Validation Efficiency

98% (54/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine-protein kinase that play a central role in mitosis. The encoded protein functions in part by phosphorylating members of the mitotic checkpoint complex and activating the spindle checkpoint. This protein also plays a role in inhibiting the activation of the anaphase promoting complex/cyclosome. This protein may also function in the DNA damage response. Mutations in this gene have been associated with aneuploidy and several forms of cancer. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
PHENOTYPE: Mice homozygous for a null mutation exhibit embryonic lethality prior to implantation. Mice homozygous for a kinase dead allele exhibit aneuploidy in somatic and germ cells and reduced male fertility. [provided by MGI curators]

Allele List at MGI

All alleles(22) : Targeted, knock-out(3) Targeted, other(4) Gene trapped(15)

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	T	11: 23,615,265		probably null	Het
3632451O06Rik	T	A	14: 49,770,436	T527S	probably damaging	Het
Adck5	A	G	15: 76,594,335		probably benign	Het
Akr1b3	A	C	6: 34,304,267		probably benign	Het
Asns	A	T	6: 7,677,978	S367T	probably damaging	Het
BC034090	T	C	1: 155,226,158	N120S	probably benign	Het
Csf1	T	A	3: 107,756,739	T38S	probably damaging	Het
Ctsz	T	C	2: 174,428,585	E268G	possibly damaging	Het
Dach1	G	A	14: 97,827,750	T685I	possibly damaging	Het
Dclre1a	A	G	19: 56,545,442	L240S	probably benign	Het
Ercc1	G	A	7: 19,347,132		probably benign	Het
Esam	C	T	9: 37,534,196	T71I	probably benign	Het
Espl1	A	G	15: 102,312,989	I944V	probably damaging	Het
Gde1	A	G	7: 118,698,558	L35P	possibly damaging	Het
Gm10382	A	G	5: 125,389,583		probably benign	Het
H2-M10.6	T	C	17: 36,813,066	Y141H	probably damaging	Het
Hk1	C	A	10: 62,315,540	K10N	probably damaging	Het
Lamc3	A	G	2: 31,898,232	K135E	probably damaging	Het
Lrtm2	A	G	6: 119,320,528	F184S	probably damaging	Het
March11	A	G	15: 26,309,446	E62G	probably damaging	Het
Mtcl1	T	A	17: 66,380,079	T611S	probably benign	Het
Myc	A	T	15: 61,989,664	H373L	probably damaging	Het
Myh6	T	A	14: 54,962,108	I249F	probably damaging	Het
Naaa	T	C	5: 92,278,143		probably benign	Het
Nfib	A	G	4: 82,323,658	V432A	probably damaging	Het
Nmt1	A	G	11: 103,043,200	K55R	probably damaging	Het
Olfr1228	T	C	2: 89,249,245	R150G	possibly damaging	Het
Opa3	C	T	7: 19,244,774	R55W	probably damaging	Het
Pfn4	T	A	12: 4,770,182	D10E	probably damaging	Het
Pld5	T	A	1: 176,140,017	I91F	probably damaging	Het
Plec	A	C	15: 76,183,117	S1350A	probably damaging	Het
Polq	G	T	16: 37,013,181	V79F	probably damaging	Het
Ppp1r16b	T	C	2: 158,761,765	Y537H	probably damaging	Het
Prdm8	T	C	5: 98,186,508	S645P	probably damaging	Het
Rgs1	T	C	1: 144,247,906	T94A	probably benign	Het
Rpl11	G	A	4: 136,051,143		probably benign	Het
Scamp3	G	A	3: 89,181,927		probably null	Het
Sgsm1	TTTTATATT	TTT	5: 113,258,123		probably benign	Het
Sirpb1b	A	T	3: 15,548,761	I87K	probably damaging	Het
Slc14a2	G	A	18: 78,207,068	R62C	probably damaging	Het
Stat4	T	C	1: 52,071,941		probably null	Het
Tex9	A	T	9: 72,480,595		probably null	Het
Tsku	T	C	7: 98,352,831	T98A	probably benign	Het
Ttc23l	CT	CTTGGATT	15: 10,537,562		probably benign	Het
Ttc23l	G	A	15: 10,537,566	S206L	probably benign	Het
Vmn2r116	A	C	17: 23,401,421	I710L	probably benign	Het
Vmn2r16	A	T	5: 109,363,801	I625F	probably damaging	Het
Xpo4	G	A	14: 57,591,022	Q794*	probably null	Het
Zfp112	T	A	7: 24,125,048	I147N	probably damaging	Het
Zmiz1	T	C	14: 25,636,010	S140P	probably damaging	Het

Other mutations in Bub1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00765:Bub1	APN	2	127829472	missense	probably damaging	0.96
IGL00795:Bub1	APN	2	127821815	missense	probably benign	0.00
IGL00966:Bub1	APN	2	127810663	missense	probably damaging	1.00
IGL01807:Bub1	APN	2	127812977	missense	probably benign	0.00
IGL02212:Bub1	APN	2	127805351	missense	probably damaging	1.00
IGL02537:Bub1	APN	2	127801347	nonsense	probably null
IGL02935:Bub1	APN	2	127801295	missense	probably damaging	1.00
IGL03064:Bub1	APN	2	127817453	missense	probably benign	0.00
R0052:Bub1	UTSW	2	127809039	missense	probably benign	0.10
R0052:Bub1	UTSW	2	127809039	missense	probably benign	0.10
R0325:Bub1	UTSW	2	127801394	nonsense	probably null
R1502:Bub1	UTSW	2	127827419	missense	probably damaging	0.98
R1627:Bub1	UTSW	2	127809013	missense	probably benign	0.01
R1743:Bub1	UTSW	2	127813850	missense	probably damaging	1.00
R1778:Bub1	UTSW	2	127803122	missense	possibly damaging	0.60
R2043:Bub1	UTSW	2	127804220	missense	probably damaging	1.00
R2108:Bub1	UTSW	2	127819335	missense	probably damaging	0.99
R2165:Bub1	UTSW	2	127801281	missense	probably benign	0.01
R2190:Bub1	UTSW	2	127810725	missense	probably benign	0.06
R2507:Bub1	UTSW	2	127801423	missense	probably benign	0.04
R2508:Bub1	UTSW	2	127801423	missense	probably benign	0.04
R3836:Bub1	UTSW	2	127814886	missense	probably damaging	1.00
R3862:Bub1	UTSW	2	127814756	splice site	probably benign
R3904:Bub1	UTSW	2	127821942	missense	probably benign	0.08
R4580:Bub1	UTSW	2	127829676	critical splice donor site	probably null
R4751:Bub1	UTSW	2	127823938	intron	probably benign
R5239:Bub1	UTSW	2	127821696	missense	probably damaging	1.00
R5498:Bub1	UTSW	2	127814709	missense	possibly damaging	0.59
R5591:Bub1	UTSW	2	127819343	missense	probably benign	0.16
R5672:Bub1	UTSW	2	127804880	missense	possibly damaging	0.70
R5907:Bub1	UTSW	2	127819222	missense	probably benign	0.02
R6714:Bub1	UTSW	2	127814732	missense	probably benign	0.08
R6781:Bub1	UTSW	2	127807857	missense	probably damaging	0.99
R6931:Bub1	UTSW	2	127801382	missense	probably damaging	1.00
R7057:Bub1	UTSW	2	127829527	missense	probably benign
R7094:Bub1	UTSW	2	127821761	missense	probably null	0.99
R8197:Bub1	UTSW	2	127801257	missense	probably damaging	1.00
R8423:Bub1	UTSW	2	127807830	missense	probably benign	0.00
R8463:Bub1	UTSW	2	127817433	missense	probably benign	0.30
R8725:Bub1	UTSW	2	127804219	missense	probably damaging	1.00
R8727:Bub1	UTSW	2	127804219	missense	probably damaging	1.00
R8840:Bub1	UTSW	2	127808007	missense	probably benign	0.01
R8904:Bub1	UTSW	2	127829702	missense	possibly damaging	0.93
R9187:Bub1	UTSW	2	127814936	missense	possibly damaging	0.68
Z1176:Bub1	UTSW	2	127829565	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTCCTCCCAGTAAGGATATTGAC -3'
(R):5'- TCAGGCACCAGGAATTCTTCAC -3'

Sequencing Primer
(F):5'- GCAGGGTAATCTTAGTGGT -3'
(R):5'- GGCACCAGGAATTCTTCACTTTAATG -3'

Posted On

2015-07-06