Mutagenetix > Incidental Mutations

Incidental Mutation 'R4373:Ppp1r16b'

326047

Institutional Source

Beutler Lab

Gene Symbol

Ppp1r16b

Ensembl Gene

ENSMUSG00000037754

Gene Name

protein phosphatase 1, regulatory (inhibitor) subunit 16B

Synonyms

C130078N17Rik, Wdt4, ANKRD4

MMRRC Submission

041675-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4373 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

158665398-158766334 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 158761765 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 537 (Y537H)

Ref Sequence

ENSEMBL: ENSMUSP00000099405 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045503] [ENSMUST00000052927] [ENSMUST00000103116] [ENSMUST00000145073]

Predicted Effect

probably damaging
Transcript: ENSMUST00000045503
AA Change: Y537H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000039540
Gene: ENSMUSG00000037754
AA Change: Y537H

Domain	Start	End	E-Value	Type
low complexity region	22	39	N/A	INTRINSIC
low complexity region	46	55	N/A	INTRINSIC
ANK	67	96	5.69e2	SMART
ANK	100	129	5.04e-6	SMART
ANK	133	162	1.76e-5	SMART
ANK	228	257	4.43e-2	SMART
ANK	261	290	1.38e-3	SMART
low complexity region	301	314	N/A	INTRINSIC
low complexity region	327	342	N/A	INTRINSIC
low complexity region	504	517	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000052927
AA Change: Y537H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000062615
Gene: ENSMUSG00000037754
AA Change: Y537H

Domain	Start	End	E-Value	Type
low complexity region	22	39	N/A	INTRINSIC
low complexity region	46	55	N/A	INTRINSIC
ANK	67	96	5.69e2	SMART
ANK	100	129	5.04e-6	SMART
ANK	133	162	1.76e-5	SMART
ANK	228	257	4.43e-2	SMART
ANK	261	290	1.38e-3	SMART
low complexity region	301	314	N/A	INTRINSIC
low complexity region	327	342	N/A	INTRINSIC
low complexity region	504	517	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000103116
AA Change: Y537H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000099405
Gene: ENSMUSG00000037754
AA Change: Y537H

Domain	Start	End	E-Value	Type
low complexity region	22	39	N/A	INTRINSIC
low complexity region	46	55	N/A	INTRINSIC
ANK	67	96	5.69e2	SMART
ANK	100	129	5.04e-6	SMART
ANK	133	162	1.76e-5	SMART
ANK	228	257	4.43e-2	SMART
ANK	261	290	1.38e-3	SMART
low complexity region	301	314	N/A	INTRINSIC
low complexity region	327	342	N/A	INTRINSIC
low complexity region	504	517	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129902

Predicted Effect

possibly damaging
Transcript: ENSMUST00000145073
AA Change: Y437H

PolyPhen 2 Score 0.768 (Sensitivity: 0.85; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000117310
Gene: ENSMUSG00000037754
AA Change: Y437H

Domain	Start	End	E-Value	Type
ANK	9	38	5.69e2	SMART
ANK	42	71	5.04e-6	SMART
ANK	75	104	1.76e-5	SMART
Blast:ANK	149	190	5e-18	BLAST
low complexity region	201	214	N/A	INTRINSIC
low complexity region	227	242	N/A	INTRINSIC
low complexity region	404	417	N/A	INTRINSIC

Meta Mutation Damage Score

0.2253

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.9%

Validation Efficiency

98% (54/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is membrane-associated and contains five ankyrin repeats, a protein phosphatase-1-interacting domain, and a carboxy-terminal CAAX box domain. Synthesis of the encoded protein is inhibited by transforming growth factor beta-1. The protein may bind to the membrane through its CAAX box domain and may act as a signaling molecule through interaction with protein phosphatase-1. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar processing to generate mature protein. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and grossly normal with no detectable defects in thymopoiesis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	T	11: 23,615,265		probably null	Het
3632451O06Rik	T	A	14: 49,770,436	T527S	probably damaging	Het
Adck5	A	G	15: 76,594,335		probably benign	Het
Akr1b3	A	C	6: 34,304,267		probably benign	Het
Asns	A	T	6: 7,677,978	S367T	probably damaging	Het
BC034090	T	C	1: 155,226,158	N120S	probably benign	Het
Bub1	A	T	2: 127,805,236		probably benign	Het
Csf1	T	A	3: 107,756,739	T38S	probably damaging	Het
Ctsz	T	C	2: 174,428,585	E268G	possibly damaging	Het
Dach1	G	A	14: 97,827,750	T685I	possibly damaging	Het
Dclre1a	A	G	19: 56,545,442	L240S	probably benign	Het
Ercc1	G	A	7: 19,347,132		probably benign	Het
Esam	C	T	9: 37,534,196	T71I	probably benign	Het
Espl1	A	G	15: 102,312,989	I944V	probably damaging	Het
Gde1	A	G	7: 118,698,558	L35P	possibly damaging	Het
Gm10382	A	G	5: 125,389,583		probably benign	Het
H2-M10.6	T	C	17: 36,813,066	Y141H	probably damaging	Het
Hk1	C	A	10: 62,315,540	K10N	probably damaging	Het
Lamc3	A	G	2: 31,898,232	K135E	probably damaging	Het
Lrtm2	A	G	6: 119,320,528	F184S	probably damaging	Het
March11	A	G	15: 26,309,446	E62G	probably damaging	Het
Mtcl1	T	A	17: 66,380,079	T611S	probably benign	Het
Myc	A	T	15: 61,989,664	H373L	probably damaging	Het
Myh6	T	A	14: 54,962,108	I249F	probably damaging	Het
Naaa	T	C	5: 92,278,143		probably benign	Het
Nfib	A	G	4: 82,323,658	V432A	probably damaging	Het
Nmt1	A	G	11: 103,043,200	K55R	probably damaging	Het
Olfr1228	T	C	2: 89,249,245	R150G	possibly damaging	Het
Opa3	C	T	7: 19,244,774	R55W	probably damaging	Het
Pfn4	T	A	12: 4,770,182	D10E	probably damaging	Het
Pld5	T	A	1: 176,140,017	I91F	probably damaging	Het
Plec	A	C	15: 76,183,117	S1350A	probably damaging	Het
Polq	G	T	16: 37,013,181	V79F	probably damaging	Het
Prdm8	T	C	5: 98,186,508	S645P	probably damaging	Het
Rgs1	T	C	1: 144,247,906	T94A	probably benign	Het
Rpl11	G	A	4: 136,051,143		probably benign	Het
Scamp3	G	A	3: 89,181,927		probably null	Het
Sgsm1	TTTTATATT	TTT	5: 113,258,123		probably benign	Het
Sirpb1b	A	T	3: 15,548,761	I87K	probably damaging	Het
Slc14a2	G	A	18: 78,207,068	R62C	probably damaging	Het
Stat4	T	C	1: 52,071,941		probably null	Het
Tex9	A	T	9: 72,480,595		probably null	Het
Tsku	T	C	7: 98,352,831	T98A	probably benign	Het
Ttc23l	CT	CTTGGATT	15: 10,537,562		probably benign	Het
Ttc23l	G	A	15: 10,537,566	S206L	probably benign	Het
Vmn2r116	A	C	17: 23,401,421	I710L	probably benign	Het
Vmn2r16	A	T	5: 109,363,801	I625F	probably damaging	Het
Xpo4	G	A	14: 57,591,022	Q794*	probably null	Het
Zfp112	T	A	7: 24,125,048	I147N	probably damaging	Het
Zmiz1	T	C	14: 25,636,010	S140P	probably damaging	Het

Other mutations in Ppp1r16b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00813:Ppp1r16b	APN	2	158756965	missense	probably damaging	1.00
IGL01024:Ppp1r16b	APN	2	158740816	splice site	probably benign
IGL01080:Ppp1r16b	APN	2	158757172	missense	probably damaging	0.99
IGL02106:Ppp1r16b	APN	2	158746531	missense	possibly damaging	0.51
IGL03084:Ppp1r16b	APN	2	158761493	nonsense	probably null
R0037:Ppp1r16b	UTSW	2	158757209	missense	probably damaging	0.98
R0037:Ppp1r16b	UTSW	2	158757209	missense	probably damaging	0.98
R0190:Ppp1r16b	UTSW	2	158696063	missense	probably damaging	1.00
R0294:Ppp1r16b	UTSW	2	158746603	missense	probably damaging	1.00
R1735:Ppp1r16b	UTSW	2	158761495	missense	possibly damaging	0.94
R1746:Ppp1r16b	UTSW	2	158746665	critical splice donor site	probably null
R1847:Ppp1r16b	UTSW	2	158761435	missense	probably damaging	0.99
R2297:Ppp1r16b	UTSW	2	158761366	missense	possibly damaging	0.88
R2509:Ppp1r16b	UTSW	2	158761463	missense	possibly damaging	0.87
R2923:Ppp1r16b	UTSW	2	158756957	missense	probably damaging	1.00
R3907:Ppp1r16b	UTSW	2	158761490	missense	probably benign	0.00
R4344:Ppp1r16b	UTSW	2	158749186	missense	probably damaging	1.00
R4423:Ppp1r16b	UTSW	2	158757254	missense	probably benign	0.00
R4424:Ppp1r16b	UTSW	2	158757254	missense	probably benign	0.00
R4425:Ppp1r16b	UTSW	2	158757254	missense	probably benign	0.00
R4623:Ppp1r16b	UTSW	2	158761463	missense	possibly damaging	0.87
R5436:Ppp1r16b	UTSW	2	158757333	intron	probably benign
R6029:Ppp1r16b	UTSW	2	158755217	missense	possibly damaging	0.74
R6119:Ppp1r16b	UTSW	2	158751127	missense	probably benign	0.00
R6816:Ppp1r16b	UTSW	2	158761675	missense	probably benign	0.00
R6941:Ppp1r16b	UTSW	2	158696148	missense	probably damaging	1.00
R7048:Ppp1r16b	UTSW	2	158757254	missense	probably benign	0.00
R7101:Ppp1r16b	UTSW	2	158761763	missense	probably damaging	1.00
R7255:Ppp1r16b	UTSW	2	158761391	missense	probably benign	0.41
R7490:Ppp1r16b	UTSW	2	158761468	missense	probably damaging	0.99
R8300:Ppp1r16b	UTSW	2	158746651	missense	probably damaging	0.98
R8359:Ppp1r16b	UTSW	2	158761375	missense	probably benign
R8677:Ppp1r16b	UTSW	2	158751178	missense	not run
R8678:Ppp1r16b	UTSW	2	158751178	missense	not run
R8678:Ppp1r16b	UTSW	2	158757022	missense	not run
R8679:Ppp1r16b	UTSW	2	158751178	missense	not run
R8755:Ppp1r16b	UTSW	2	158751178	missense	not run
R8756:Ppp1r16b	UTSW	2	158751178	missense	not run
X0064:Ppp1r16b	UTSW	2	158751127	missense	probably benign	0.00
Z1177:Ppp1r16b	UTSW	2	158761434	missense	probably benign	0.18
Z1177:Ppp1r16b	UTSW	2	158761814	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATGCCTGACTACAGCATGGC -3'
(R):5'- GCATTCCTCTAGAAAGCAGATCC -3'

Sequencing Primer
(F):5'- TGACTACAGCATGGCCTACG -3'
(R):5'- TCTAGAAAGCAGATCCCACCTCTC -3'

Posted On

2015-07-06