Incidental Mutation 'R4373:Ctsz'
ID326048
Institutional Source Beutler Lab
Gene Symbol Ctsz
Ensembl Gene ENSMUSG00000016256
Gene Namecathepsin Z
Synonymscathepsin X, CTSX, D2Wsu143e
MMRRC Submission 041675-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.170) question?
Stock #R4373 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location174427493-174439039 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 174428585 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 268 (E268G)
Ref Sequence ENSEMBL: ENSMUSP00000016400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016397] [ENSMUST00000016400] [ENSMUST00000109075]
Predicted Effect probably benign
Transcript: ENSMUST00000016397
SMART Domains Protein: ENSMUSP00000016397
Gene: ENSMUSG00000016253

DomainStartEndE-ValueType
Pfam:TH1 11 604 6.5e-276 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000016400
AA Change: E268G

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000016400
Gene: ENSMUSG00000016256
AA Change: E268G

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pept_C1 64 301 5.46e-51 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109075
SMART Domains Protein: ENSMUSP00000104703
Gene: ENSMUSG00000016253

DomainStartEndE-ValueType
Pfam:TH1 10 590 5.6e-303 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137986
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139390
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143683
Meta Mutation Damage Score 0.5655 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: This gene encodes a member of the peptidase C1 (papain) family of cysteine proteases. The encoded preproprotein is proteolytically processed to generate a mature enzyme with carboxypeptidase activity. An enzymatically inactive form of the protein, that is associated with the propeptide, may be involved in cancer cell invasion and proliferation. Homozygous knockout mice for this gene exhibit impaired cancer cell invasion in a breast cancer model. [provided by RefSeq, Aug 2015]
PHENOTYPE: No abnormal pheotype detected in homozygous mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A T 11: 23,615,265 probably null Het
3632451O06Rik T A 14: 49,770,436 T527S probably damaging Het
Adck5 A G 15: 76,594,335 probably benign Het
Akr1b3 A C 6: 34,304,267 probably benign Het
Asns A T 6: 7,677,978 S367T probably damaging Het
BC034090 T C 1: 155,226,158 N120S probably benign Het
Bub1 A T 2: 127,805,236 probably benign Het
Csf1 T A 3: 107,756,739 T38S probably damaging Het
Dach1 G A 14: 97,827,750 T685I possibly damaging Het
Dclre1a A G 19: 56,545,442 L240S probably benign Het
Ercc1 G A 7: 19,347,132 probably benign Het
Esam C T 9: 37,534,196 T71I probably benign Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Gde1 A G 7: 118,698,558 L35P possibly damaging Het
Gm10382 A G 5: 125,389,583 probably benign Het
H2-M10.6 T C 17: 36,813,066 Y141H probably damaging Het
Hk1 C A 10: 62,315,540 K10N probably damaging Het
Lamc3 A G 2: 31,898,232 K135E probably damaging Het
Lrtm2 A G 6: 119,320,528 F184S probably damaging Het
March11 A G 15: 26,309,446 E62G probably damaging Het
Mtcl1 T A 17: 66,380,079 T611S probably benign Het
Myc A T 15: 61,989,664 H373L probably damaging Het
Myh6 T A 14: 54,962,108 I249F probably damaging Het
Naaa T C 5: 92,278,143 probably benign Het
Nfib A G 4: 82,323,658 V432A probably damaging Het
Nmt1 A G 11: 103,043,200 K55R probably damaging Het
Olfr1228 T C 2: 89,249,245 R150G possibly damaging Het
Opa3 C T 7: 19,244,774 R55W probably damaging Het
Pfn4 T A 12: 4,770,182 D10E probably damaging Het
Pld5 T A 1: 176,140,017 I91F probably damaging Het
Plec A C 15: 76,183,117 S1350A probably damaging Het
Polq G T 16: 37,013,181 V79F probably damaging Het
Ppp1r16b T C 2: 158,761,765 Y537H probably damaging Het
Prdm8 T C 5: 98,186,508 S645P probably damaging Het
Rgs1 T C 1: 144,247,906 T94A probably benign Het
Rpl11 G A 4: 136,051,143 probably benign Het
Scamp3 G A 3: 89,181,927 probably null Het
Sgsm1 TTTTATATT TTT 5: 113,258,123 probably benign Het
Sirpb1b A T 3: 15,548,761 I87K probably damaging Het
Slc14a2 G A 18: 78,207,068 R62C probably damaging Het
Stat4 T C 1: 52,071,941 probably null Het
Tex9 A T 9: 72,480,595 probably null Het
Tsku T C 7: 98,352,831 T98A probably benign Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Vmn2r116 A C 17: 23,401,421 I710L probably benign Het
Vmn2r16 A T 5: 109,363,801 I625F probably damaging Het
Xpo4 G A 14: 57,591,022 Q794* probably null Het
Zfp112 T A 7: 24,125,048 I147N probably damaging Het
Zmiz1 T C 14: 25,636,010 S140P probably damaging Het
Other mutations in Ctsz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00957:Ctsz APN 2 174427978 missense probably damaging 0.99
IGL02574:Ctsz APN 2 174429098 missense probably benign 0.16
IGL03342:Ctsz APN 2 174429140 missense possibly damaging 0.92
IGL03348:Ctsz APN 2 174428697 missense probably damaging 0.98
R1872:Ctsz UTSW 2 174427976 missense probably benign
R4890:Ctsz UTSW 2 174428600 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTTGACCCCAGCCTTAACTG -3'
(R):5'- ATAACTTTTCACAGCTGCGGG -3'

Sequencing Primer
(F):5'- AACTGTTTCCCGAGCACCG -3'
(R):5'- ACTTTTCACAGCTGCGGGATAATG -3'
Posted On2015-07-06