Incidental Mutation 'R4373:Sirpb1b'
ID326049
Institutional Source Beutler Lab
Gene Symbol Sirpb1b
Ensembl Gene ENSMUSG00000095028
Gene Namesignal-regulatory protein beta 1B
Synonyms
MMRRC Submission 041675-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R4373 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location15495751-15575065 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 15548761 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 87 (I87K)
Ref Sequence ENSEMBL: ENSMUSP00000142068 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091319] [ENSMUST00000192382] [ENSMUST00000195778]
Predicted Effect probably damaging
Transcript: ENSMUST00000091319
AA Change: I87K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000088869
Gene: ENSMUSG00000095028
AA Change: I87K

DomainStartEndE-ValueType
low complexity region 15 23 N/A INTRINSIC
IG 37 143 8.19e-9 SMART
IGc1 163 236 1.22e-4 SMART
IGc1 266 339 2.21e-5 SMART
transmembrane domain 364 386 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000192382
AA Change: I87K

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000142068
Gene: ENSMUSG00000095028
AA Change: I87K

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
IG 37 143 3.3e-11 SMART
IGc1 163 236 5.1e-7 SMART
Pfam:C2-set_2 251 340 1e-4 PFAM
Pfam:Ig_2 251 348 2.7e-1 PFAM
Pfam:C1-set 258 341 1.3e-13 PFAM
transmembrane domain 370 392 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193767
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194767
Predicted Effect probably benign
Transcript: ENSMUST00000195778
SMART Domains Protein: ENSMUSP00000141533
Gene: ENSMUSG00000095028

DomainStartEndE-ValueType
Pfam:Ig_2 14 66 5.6e-1 PFAM
Pfam:Ig_3 22 52 7.8e-3 PFAM
Pfam:V-set 24 75 1.9e-7 PFAM
IGc1 96 169 5.1e-7 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A T 11: 23,615,265 probably null Het
3632451O06Rik T A 14: 49,770,436 T527S probably damaging Het
Adck5 A G 15: 76,594,335 probably benign Het
Akr1b3 A C 6: 34,304,267 probably benign Het
Asns A T 6: 7,677,978 S367T probably damaging Het
BC034090 T C 1: 155,226,158 N120S probably benign Het
Bub1 A T 2: 127,805,236 probably benign Het
Csf1 T A 3: 107,756,739 T38S probably damaging Het
Ctsz T C 2: 174,428,585 E268G possibly damaging Het
Dach1 G A 14: 97,827,750 T685I possibly damaging Het
Dclre1a A G 19: 56,545,442 L240S probably benign Het
Ercc1 G A 7: 19,347,132 probably benign Het
Esam C T 9: 37,534,196 T71I probably benign Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Gde1 A G 7: 118,698,558 L35P possibly damaging Het
Gm10382 A G 5: 125,389,583 probably benign Het
H2-M10.6 T C 17: 36,813,066 Y141H probably damaging Het
Hk1 C A 10: 62,315,540 K10N probably damaging Het
Lamc3 A G 2: 31,898,232 K135E probably damaging Het
Lrtm2 A G 6: 119,320,528 F184S probably damaging Het
March11 A G 15: 26,309,446 E62G probably damaging Het
Mtcl1 T A 17: 66,380,079 T611S probably benign Het
Myc A T 15: 61,989,664 H373L probably damaging Het
Myh6 T A 14: 54,962,108 I249F probably damaging Het
Naaa T C 5: 92,278,143 probably benign Het
Nfib A G 4: 82,323,658 V432A probably damaging Het
Nmt1 A G 11: 103,043,200 K55R probably damaging Het
Olfr1228 T C 2: 89,249,245 R150G possibly damaging Het
Opa3 C T 7: 19,244,774 R55W probably damaging Het
Pfn4 T A 12: 4,770,182 D10E probably damaging Het
Pld5 T A 1: 176,140,017 I91F probably damaging Het
Plec A C 15: 76,183,117 S1350A probably damaging Het
Polq G T 16: 37,013,181 V79F probably damaging Het
Ppp1r16b T C 2: 158,761,765 Y537H probably damaging Het
Prdm8 T C 5: 98,186,508 S645P probably damaging Het
Rgs1 T C 1: 144,247,906 T94A probably benign Het
Rpl11 G A 4: 136,051,143 probably benign Het
Scamp3 G A 3: 89,181,927 probably null Het
Sgsm1 TTTTATATT TTT 5: 113,258,123 probably benign Het
Slc14a2 G A 18: 78,207,068 R62C probably damaging Het
Stat4 T C 1: 52,071,941 probably null Het
Tex9 A T 9: 72,480,595 probably null Het
Tsku T C 7: 98,352,831 T98A probably benign Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Vmn2r116 A C 17: 23,401,421 I710L probably benign Het
Vmn2r16 A T 5: 109,363,801 I625F probably damaging Het
Xpo4 G A 14: 57,591,022 Q794* probably null Het
Zfp112 T A 7: 24,125,048 I147N probably damaging Het
Zmiz1 T C 14: 25,636,010 S140P probably damaging Het
Other mutations in Sirpb1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01384:Sirpb1b APN 3 15548729 missense probably damaging 0.99
IGL01662:Sirpb1b APN 3 15543184 missense probably damaging 1.00
IGL02025:Sirpb1b APN 3 15548803 missense probably damaging 0.99
F5770:Sirpb1b UTSW 3 15503183 missense probably benign 0.25
R0419:Sirpb1b UTSW 3 15548596 missense probably damaging 1.00
R1538:Sirpb1b UTSW 3 15548759 missense possibly damaging 0.81
R3935:Sirpb1b UTSW 3 15548783 missense probably benign 0.05
R4300:Sirpb1b UTSW 3 15548761 missense probably damaging 1.00
R4953:Sirpb1b UTSW 3 15548827 missense probably damaging 1.00
R5425:Sirpb1b UTSW 3 15548669 missense probably damaging 1.00
R6340:Sirpb1b UTSW 3 15548665 missense probably damaging 1.00
R6357:Sirpb1b UTSW 3 15503183 missense possibly damaging 0.79
R6723:Sirpb1b UTSW 3 15548798 missense possibly damaging 0.78
R7152:Sirpb1b UTSW 3 15542170 missense probably benign 0.25
R7390:Sirpb1b UTSW 3 15543040 nonsense probably null
R7411:Sirpb1b UTSW 3 15542997 missense probably benign 0.22
R7513:Sirpb1b UTSW 3 15542140 nonsense probably null
R7526:Sirpb1b UTSW 3 15548872 missense probably damaging 1.00
V7583:Sirpb1b UTSW 3 15503183 missense probably benign 0.25
Z1177:Sirpb1b UTSW 3 15574941 missense not run
Predicted Primers PCR Primer
(F):5'- GAGTCTTCAGACCTGTAGGAGAAATG -3'
(R):5'- GAGAGCTGAAGGTGATCCAACC -3'

Sequencing Primer
(F):5'- CAGACCTGTAGGAGAAATGAAGAATG -3'
(R):5'- CTGAAGGTGATCCAACCTGTTAAATC -3'
Posted On2015-07-06