Mutagenetix > Incidental Mutations

Incidental Mutation 'R4373:Vmn2r16'

326056

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r16

Ensembl Gene

ENSMUSG00000092080

Gene Name

vomeronasal 2, receptor 16

Synonyms

EG384220

MMRRC Submission

041675-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.204) question?

Stock #

R4373 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

109330381-109364481 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 109363801 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 625 (I625F)

Ref Sequence

ENSEMBL: ENSMUSP00000127838 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000165180]

Predicted Effect

probably damaging
Transcript: ENSMUST00000165180
AA Change: I625F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000127838
Gene: ENSMUSG00000092080
AA Change: I625F

Domain	Start	End	E-Value	Type
signal peptide	1	24	N/A	INTRINSIC
Pfam:ANF_receptor	76	425	2.3e-28	PFAM
Pfam:NCD3G	509	563	8.2e-19	PFAM
Pfam:7tm_3	596	831	3.5e-56	PFAM

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.9%

Validation Efficiency

98% (54/55)

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	T	11: 23,615,265		probably null	Het
3632451O06Rik	T	A	14: 49,770,436	T527S	probably damaging	Het
Adck5	A	G	15: 76,594,335		probably benign	Het
Akr1b3	A	C	6: 34,304,267		probably benign	Het
Asns	A	T	6: 7,677,978	S367T	probably damaging	Het
BC034090	T	C	1: 155,226,158	N120S	probably benign	Het
Bub1	A	T	2: 127,805,236		probably benign	Het
Csf1	T	A	3: 107,756,739	T38S	probably damaging	Het
Ctsz	T	C	2: 174,428,585	E268G	possibly damaging	Het
Dach1	G	A	14: 97,827,750	T685I	possibly damaging	Het
Dclre1a	A	G	19: 56,545,442	L240S	probably benign	Het
Ercc1	G	A	7: 19,347,132		probably benign	Het
Esam	C	T	9: 37,534,196	T71I	probably benign	Het
Espl1	A	G	15: 102,312,989	I944V	probably damaging	Het
Gde1	A	G	7: 118,698,558	L35P	possibly damaging	Het
Gm10382	A	G	5: 125,389,583		probably benign	Het
H2-M10.6	T	C	17: 36,813,066	Y141H	probably damaging	Het
Hk1	C	A	10: 62,315,540	K10N	probably damaging	Het
Lamc3	A	G	2: 31,898,232	K135E	probably damaging	Het
Lrtm2	A	G	6: 119,320,528	F184S	probably damaging	Het
March11	A	G	15: 26,309,446	E62G	probably damaging	Het
Mtcl1	T	A	17: 66,380,079	T611S	probably benign	Het
Myc	A	T	15: 61,989,664	H373L	probably damaging	Het
Myh6	T	A	14: 54,962,108	I249F	probably damaging	Het
Naaa	T	C	5: 92,278,143		probably benign	Het
Nfib	A	G	4: 82,323,658	V432A	probably damaging	Het
Nmt1	A	G	11: 103,043,200	K55R	probably damaging	Het
Olfr1228	T	C	2: 89,249,245	R150G	possibly damaging	Het
Opa3	C	T	7: 19,244,774	R55W	probably damaging	Het
Pfn4	T	A	12: 4,770,182	D10E	probably damaging	Het
Pld5	T	A	1: 176,140,017	I91F	probably damaging	Het
Plec	A	C	15: 76,183,117	S1350A	probably damaging	Het
Polq	G	T	16: 37,013,181	V79F	probably damaging	Het
Ppp1r16b	T	C	2: 158,761,765	Y537H	probably damaging	Het
Prdm8	T	C	5: 98,186,508	S645P	probably damaging	Het
Rgs1	T	C	1: 144,247,906	T94A	probably benign	Het
Rpl11	G	A	4: 136,051,143		probably benign	Het
Scamp3	G	A	3: 89,181,927		probably null	Het
Sgsm1	TTTTATATT	TTT	5: 113,258,123		probably benign	Het
Sirpb1b	A	T	3: 15,548,761	I87K	probably damaging	Het
Slc14a2	G	A	18: 78,207,068	R62C	probably damaging	Het
Stat4	T	C	1: 52,071,941		probably null	Het
Tex9	A	T	9: 72,480,595		probably null	Het
Tsku	T	C	7: 98,352,831	T98A	probably benign	Het
Ttc23l	CT	CTTGGATT	15: 10,537,562		probably benign	Het
Ttc23l	G	A	15: 10,537,566	S206L	probably benign	Het
Vmn2r116	A	C	17: 23,401,421	I710L	probably benign	Het
Xpo4	G	A	14: 57,591,022	Q794*	probably null	Het
Zfp112	T	A	7: 24,125,048	I147N	probably damaging	Het
Zmiz1	T	C	14: 25,636,010	S140P	probably damaging	Het

Other mutations in Vmn2r16

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01116:Vmn2r16	APN	5	109340428	missense	probably damaging	1.00
IGL01374:Vmn2r16	APN	5	109330417	missense	probably benign	0.00
IGL01391:Vmn2r16	APN	5	109363761	missense	possibly damaging	0.50
IGL01419:Vmn2r16	APN	5	109362401	splice site	probably benign
IGL01634:Vmn2r16	APN	5	109340311	missense	probably benign	0.00
IGL01845:Vmn2r16	APN	5	109363896	missense	probably damaging	1.00
IGL01875:Vmn2r16	APN	5	109330411	missense	probably benign	0.01
IGL01910:Vmn2r16	APN	5	109340085	missense	probably damaging	1.00
IGL02217:Vmn2r16	APN	5	109339810	missense	probably damaging	0.98
IGL02327:Vmn2r16	APN	5	109340121	missense	probably benign	0.01
IGL02491:Vmn2r16	APN	5	109339837	nonsense	probably null
IGL02531:Vmn2r16	APN	5	109340268	missense	probably damaging	0.99
IGL02680:Vmn2r16	APN	5	109340082	missense	probably benign	0.44
IGL02884:Vmn2r16	APN	5	109360891	missense	possibly damaging	0.94
IGL03084:Vmn2r16	APN	5	109330426	missense	probably damaging	0.99
IGL03096:Vmn2r16	APN	5	109339885	missense	probably damaging	0.99
IGL03355:Vmn2r16	APN	5	109363714	missense	possibly damaging	0.74
R0280:Vmn2r16	UTSW	5	109340139	missense	possibly damaging	0.88
R0594:Vmn2r16	UTSW	5	109363896	missense	probably damaging	1.00
R1016:Vmn2r16	UTSW	5	109339888	missense	probably damaging	1.00
R1109:Vmn2r16	UTSW	5	109339786	missense	probably damaging	0.98
R1248:Vmn2r16	UTSW	5	109360777	missense	probably benign	0.10
R1626:Vmn2r16	UTSW	5	109363577	missense	probably damaging	1.00
R1909:Vmn2r16	UTSW	5	109363987	missense	probably benign	0.01
R1929:Vmn2r16	UTSW	5	109339258	missense	possibly damaging	0.92
R1982:Vmn2r16	UTSW	5	109364024	missense	probably benign	0.01
R3038:Vmn2r16	UTSW	5	109339333	missense	probably damaging	1.00
R3437:Vmn2r16	UTSW	5	109330496	missense	probably damaging	0.99
R3734:Vmn2r16	UTSW	5	109330414	missense	probably benign	0.11
R3820:Vmn2r16	UTSW	5	109362277	missense	probably benign	0.36
R3873:Vmn2r16	UTSW	5	109340311	missense	probably benign	0.33
R4165:Vmn2r16	UTSW	5	109330561	missense	possibly damaging	0.80
R4575:Vmn2r16	UTSW	5	109363799	missense	possibly damaging	0.81
R4576:Vmn2r16	UTSW	5	109363799	missense	possibly damaging	0.81
R4578:Vmn2r16	UTSW	5	109363799	missense	possibly damaging	0.81
R4637:Vmn2r16	UTSW	5	109330414	missense	probably benign	0.00
R4696:Vmn2r16	UTSW	5	109339302	missense	probably benign	0.01
R5026:Vmn2r16	UTSW	5	109360856	nonsense	probably null
R5180:Vmn2r16	UTSW	5	109330525	missense	probably benign	0.01
R5433:Vmn2r16	UTSW	5	109363842	missense	probably damaging	1.00
R5955:Vmn2r16	UTSW	5	109363747	missense	possibly damaging	0.78
R5958:Vmn2r16	UTSW	5	109362287	missense	possibly damaging	0.81
R6353:Vmn2r16	UTSW	5	109340253	missense	probably benign	0.33
R6389:Vmn2r16	UTSW	5	109330478	missense	probably benign	0.19
R6819:Vmn2r16	UTSW	5	109340546	missense	probably benign	0.04
R6994:Vmn2r16	UTSW	5	109340103	missense	probably damaging	1.00
R7061:Vmn2r16	UTSW	5	109363754	missense	probably damaging	0.99
R7063:Vmn2r16	UTSW	5	109363784	missense	probably damaging	1.00
R7220:Vmn2r16	UTSW	5	109360906	missense	probably damaging	0.97
R7268:Vmn2r16	UTSW	5	109340465	nonsense	probably null
R7420:Vmn2r16	UTSW	5	109363870	missense	probably damaging	0.96
R7591:Vmn2r16	UTSW	5	109362357	missense	probably damaging	0.99
R7644:Vmn2r16	UTSW	5	109339971	missense	probably damaging	1.00
X0027:Vmn2r16	UTSW	5	109339309	missense	probably damaging	1.00
Z1088:Vmn2r16	UTSW	5	109340515	missense	probably benign	0.03
Z1088:Vmn2r16	UTSW	5	109363913	frame shift	probably null

Predicted Primers

PCR Primer
(F):5'- ACTGCCTCCAAAGAGCTGTG -3'
(R):5'- ATAGGAATGACCAAGTTAGGTGTCC -3'

Sequencing Primer
(F):5'- CCAAAGAGCTGTGTCATTTCTGGC -3'
(R):5'- ACCAAGTTAGGTGTCCCTGATGC -3'

Posted On

2015-07-06