Mutagenetix > Incidental Mutation

Incidental Mutation 'R4373:Asns'

326059

Institutional Source

Beutler Lab

Gene Symbol

Asns

Ensembl Gene

ENSMUSG00000029752

Gene Name

asparagine synthetase

Synonyms

MMRRC Submission

041675-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.297) question?

Stock #

R4373 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

7675169-7693254 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 7677978 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 367 (S367T)

Ref Sequence

ENSEMBL: ENSMUSP00000111204 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031766] [ENSMUST00000115542] [ENSMUST00000126303]

AlphaFold

Q61024

Predicted Effect

probably damaging
Transcript: ENSMUST00000031766
AA Change: S367T

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000031766
Gene: ENSMUSG00000029752
AA Change: S367T

Domain	Start	End	E-Value	Type
Pfam:GATase_6	29	160	4.3e-21	PFAM
Pfam:GATase_7	47	166	9.1e-26	PFAM
Pfam:DUF3700	68	178	5.5e-6	PFAM
Pfam:GATase_2	91	161	3.3e-5	PFAM
Pfam:Asn_synthase	234	467	1.7e-61	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000115542
AA Change: S367T

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000111204
Gene: ENSMUSG00000029752
AA Change: S367T

Domain	Start	End	E-Value	Type
Pfam:GATase_6	29	160	1.2e-19	PFAM
Pfam:GATase_7	47	166	4.8e-25	PFAM
Pfam:DUF3700	64	180	3.3e-6	PFAM
Pfam:Asn_synthase	234	390	2.4e-46	PFAM
Pfam:Asn_synthase	382	547	1.5e-35	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000126303

SMART Domains

Protein: ENSMUSP00000115415
Gene: ENSMUSG00000029752

Domain	Start	End	E-Value	Type
Pfam:GATase_6	28	160	1.3e-24	PFAM
Pfam:GATase_7	47	166	3.1e-29	PFAM
Pfam:DUF3700	67	180	6.3e-10	PFAM
Pfam:GATase_2	89	161	1.4e-8	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133972

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140097

Meta Mutation Damage Score

0.8936

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.9%

Validation Efficiency

98% (54/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in the synthesis of asparagine. This gene complements a mutation in the temperature-sensitive hamster mutant ts11, which blocks progression through the G1 phase of the cell cycle at nonpermissive temperature. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a hypomophic allele exhibit structural brain abnormalities, including enlarged ventricles and reduced cortical thickness, and deficits in short- and long-term memory. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	T	11: 23,615,265		probably null	Het
3632451O06Rik	T	A	14: 49,770,436	T527S	probably damaging	Het
Adck5	A	G	15: 76,594,335		probably benign	Het
Akr1b3	A	C	6: 34,304,267		probably benign	Het
BC034090	T	C	1: 155,226,158	N120S	probably benign	Het
Bub1	A	T	2: 127,805,236		probably benign	Het
Csf1	T	A	3: 107,756,739	T38S	probably damaging	Het
Ctsz	T	C	2: 174,428,585	E268G	possibly damaging	Het
Dach1	G	A	14: 97,827,750	T685I	possibly damaging	Het
Dclre1a	A	G	19: 56,545,442	L240S	probably benign	Het
Ercc1	G	A	7: 19,347,132		probably benign	Het
Esam	C	T	9: 37,534,196	T71I	probably benign	Het
Espl1	A	G	15: 102,312,989	I944V	probably damaging	Het
Gde1	A	G	7: 118,698,558	L35P	possibly damaging	Het
Gm10382	A	G	5: 125,389,583		probably benign	Het
H2-M10.6	T	C	17: 36,813,066	Y141H	probably damaging	Het
Hk1	C	A	10: 62,315,540	K10N	probably damaging	Het
Lamc3	A	G	2: 31,898,232	K135E	probably damaging	Het
Lrtm2	A	G	6: 119,320,528	F184S	probably damaging	Het
March11	A	G	15: 26,309,446	E62G	probably damaging	Het
Mtcl1	T	A	17: 66,380,079	T611S	probably benign	Het
Myc	A	T	15: 61,989,664	H373L	probably damaging	Het
Myh6	T	A	14: 54,962,108	I249F	probably damaging	Het
Naaa	T	C	5: 92,278,143		probably benign	Het
Nfib	A	G	4: 82,323,658	V432A	probably damaging	Het
Nmt1	A	G	11: 103,043,200	K55R	probably damaging	Het
Olfr1228	T	C	2: 89,249,245	R150G	possibly damaging	Het
Opa3	C	T	7: 19,244,774	R55W	probably damaging	Het
Pfn4	T	A	12: 4,770,182	D10E	probably damaging	Het
Pld5	T	A	1: 176,140,017	I91F	probably damaging	Het
Plec	A	C	15: 76,183,117	S1350A	probably damaging	Het
Polq	G	T	16: 37,013,181	V79F	probably damaging	Het
Ppp1r16b	T	C	2: 158,761,765	Y537H	probably damaging	Het
Prdm8	T	C	5: 98,186,508	S645P	probably damaging	Het
Rgs1	T	C	1: 144,247,906	T94A	probably benign	Het
Rpl11	G	A	4: 136,051,143		probably benign	Het
Scamp3	G	A	3: 89,181,927		probably null	Het
Sgsm1	TTTTATATT	TTT	5: 113,258,123		probably benign	Het
Sirpb1b	A	T	3: 15,548,761	I87K	probably damaging	Het
Slc14a2	G	A	18: 78,207,068	R62C	probably damaging	Het
Stat4	T	C	1: 52,071,941		probably null	Het
Tex9	A	T	9: 72,480,595		probably null	Het
Tsku	T	C	7: 98,352,831	T98A	probably benign	Het
Ttc23l	CT	CTTGGATT	15: 10,537,562		probably benign	Het
Ttc23l	G	A	15: 10,537,566	S206L	probably benign	Het
Vmn2r116	A	C	17: 23,401,421	I710L	probably benign	Het
Vmn2r16	A	T	5: 109,363,801	I625F	probably damaging	Het
Xpo4	G	A	14: 57,591,022	Q794*	probably null	Het
Zfp112	T	A	7: 24,125,048	I147N	probably damaging	Het
Zmiz1	T	C	14: 25,636,010	S140P	probably damaging	Het

Other mutations in Asns

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00264:Asns	APN	6	7680179	missense	probably damaging	1.00
IGL00656:Asns	APN	6	7680215	unclassified	probably benign
IGL01534:Asns	APN	6	7675397	missense	probably benign	0.03
IGL01996:Asns	APN	6	7682378	missense	possibly damaging	0.56
IGL02058:Asns	APN	6	7685184	missense	probably damaging	1.00
IGL02311:Asns	APN	6	7676233	critical splice donor site	probably null
IGL02367:Asns	APN	6	7685411	splice site	probably benign
IGL03263:Asns	APN	6	7689404	missense	probably benign	0.07
IGL03341:Asns	APN	6	7682002	missense	probably damaging	0.98
PIT4445001:Asns	UTSW	6	7689277	missense	probably damaging	1.00
R0034:Asns	UTSW	6	7676299	missense	probably damaging	1.00
R0034:Asns	UTSW	6	7676299	missense	probably damaging	1.00
R0050:Asns	UTSW	6	7676019	missense	probably benign	0.02
R0627:Asns	UTSW	6	7675516	missense	probably benign	0.05
R1075:Asns	UTSW	6	7676076	nonsense	probably null
R1591:Asns	UTSW	6	7678007	missense	probably damaging	0.97
R2047:Asns	UTSW	6	7680093	missense	probably damaging	0.99
R2232:Asns	UTSW	6	7689316	missense	possibly damaging	0.82
R2907:Asns	UTSW	6	7675506	missense	probably benign	0.03
R3907:Asns	UTSW	6	7682270	critical splice donor site	probably null
R4438:Asns	UTSW	6	7675320	missense	probably benign	0.15
R4660:Asns	UTSW	6	7678012	missense	probably benign	0.05
R4784:Asns	UTSW	6	7678029	missense	probably benign	0.12
R5655:Asns	UTSW	6	7685309	missense	probably benign	0.31
R5752:Asns	UTSW	6	7689365	missense	probably damaging	1.00
R5863:Asns	UTSW	6	7675443	nonsense	probably null
R5864:Asns	UTSW	6	7675443	nonsense	probably null
R5953:Asns	UTSW	6	7682285	missense	probably benign	0.00
R6773:Asns	UTSW	6	7676284	missense	probably benign	0.01
R6789:Asns	UTSW	6	7675344	missense	probably benign
R7389:Asns	UTSW	6	7689291	missense	probably damaging	1.00
R7524:Asns	UTSW	6	7677259	splice site	probably null
R7783:Asns	UTSW	6	7677978	missense	probably damaging	1.00
R7949:Asns	UTSW	6	7685328	missense	probably damaging	0.97
R8722:Asns	UTSW	6	7676085	missense	probably damaging	1.00
R9405:Asns	UTSW	6	7689283	missense	probably damaging	0.99
R9663:Asns	UTSW	6	7680132	missense	probably damaging	1.00
R9697:Asns	UTSW	6	7689268	missense	probably damaging	1.00
R9798:Asns	UTSW	6	7689395	missense	possibly damaging	0.92

Predicted Primers

PCR Primer
(F):5'- ATCCTCCGAAGTGCTTAGTG -3'
(R):5'- TGGATTGACAGCTTGTAGATGAC -3'

Sequencing Primer
(F):5'- CCTCCGAAGTGCTTAGTGTGAAAAC -3'
(R):5'- GACTTACAAATTTCCGATCCTTTTGG -3'

Posted On

2015-07-06