Incidental Mutation 'R4373:Asns'
ID326059
Institutional Source Beutler Lab
Gene Symbol Asns
Ensembl Gene ENSMUSG00000029752
Gene Nameasparagine synthetase
Synonyms
MMRRC Submission 041675-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.385) question?
Stock #R4373 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location7675169-7693254 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 7677978 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 367 (S367T)
Ref Sequence ENSEMBL: ENSMUSP00000111204 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031766] [ENSMUST00000115542] [ENSMUST00000126303]
Predicted Effect probably damaging
Transcript: ENSMUST00000031766
AA Change: S367T

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000031766
Gene: ENSMUSG00000029752
AA Change: S367T

DomainStartEndE-ValueType
Pfam:GATase_6 29 160 4.3e-21 PFAM
Pfam:GATase_7 47 166 9.1e-26 PFAM
Pfam:DUF3700 68 178 5.5e-6 PFAM
Pfam:GATase_2 91 161 3.3e-5 PFAM
Pfam:Asn_synthase 234 467 1.7e-61 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000115542
AA Change: S367T

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000111204
Gene: ENSMUSG00000029752
AA Change: S367T

DomainStartEndE-ValueType
Pfam:GATase_6 29 160 1.2e-19 PFAM
Pfam:GATase_7 47 166 4.8e-25 PFAM
Pfam:DUF3700 64 180 3.3e-6 PFAM
Pfam:Asn_synthase 234 390 2.4e-46 PFAM
Pfam:Asn_synthase 382 547 1.5e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126303
SMART Domains Protein: ENSMUSP00000115415
Gene: ENSMUSG00000029752

DomainStartEndE-ValueType
Pfam:GATase_6 28 160 1.3e-24 PFAM
Pfam:GATase_7 47 166 3.1e-29 PFAM
Pfam:DUF3700 67 180 6.3e-10 PFAM
Pfam:GATase_2 89 161 1.4e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133972
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140097
Meta Mutation Damage Score 0.8936 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in the synthesis of asparagine. This gene complements a mutation in the temperature-sensitive hamster mutant ts11, which blocks progression through the G1 phase of the cell cycle at nonpermissive temperature. Alternatively spliced transcript variants have been described for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a hypomophic allele exhibit structural brain abnormalities, including enlarged ventricles and reduced cortical thickness, and deficits in short- and long-term memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A T 11: 23,615,265 probably null Het
3632451O06Rik T A 14: 49,770,436 T527S probably damaging Het
Adck5 A G 15: 76,594,335 probably benign Het
Akr1b3 A C 6: 34,304,267 probably benign Het
BC034090 T C 1: 155,226,158 N120S probably benign Het
Bub1 A T 2: 127,805,236 probably benign Het
Csf1 T A 3: 107,756,739 T38S probably damaging Het
Ctsz T C 2: 174,428,585 E268G possibly damaging Het
Dach1 G A 14: 97,827,750 T685I possibly damaging Het
Dclre1a A G 19: 56,545,442 L240S probably benign Het
Ercc1 G A 7: 19,347,132 probably benign Het
Esam C T 9: 37,534,196 T71I probably benign Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Gde1 A G 7: 118,698,558 L35P possibly damaging Het
Gm10382 A G 5: 125,389,583 probably benign Het
H2-M10.6 T C 17: 36,813,066 Y141H probably damaging Het
Hk1 C A 10: 62,315,540 K10N probably damaging Het
Lamc3 A G 2: 31,898,232 K135E probably damaging Het
Lrtm2 A G 6: 119,320,528 F184S probably damaging Het
March11 A G 15: 26,309,446 E62G probably damaging Het
Mtcl1 T A 17: 66,380,079 T611S probably benign Het
Myc A T 15: 61,989,664 H373L probably damaging Het
Myh6 T A 14: 54,962,108 I249F probably damaging Het
Naaa T C 5: 92,278,143 probably benign Het
Nfib A G 4: 82,323,658 V432A probably damaging Het
Nmt1 A G 11: 103,043,200 K55R probably damaging Het
Olfr1228 T C 2: 89,249,245 R150G possibly damaging Het
Opa3 C T 7: 19,244,774 R55W probably damaging Het
Pfn4 T A 12: 4,770,182 D10E probably damaging Het
Pld5 T A 1: 176,140,017 I91F probably damaging Het
Plec A C 15: 76,183,117 S1350A probably damaging Het
Polq G T 16: 37,013,181 V79F probably damaging Het
Ppp1r16b T C 2: 158,761,765 Y537H probably damaging Het
Prdm8 T C 5: 98,186,508 S645P probably damaging Het
Rgs1 T C 1: 144,247,906 T94A probably benign Het
Rpl11 G A 4: 136,051,143 probably benign Het
Scamp3 G A 3: 89,181,927 probably null Het
Sgsm1 TTTTATATT TTT 5: 113,258,123 probably benign Het
Sirpb1b A T 3: 15,548,761 I87K probably damaging Het
Slc14a2 G A 18: 78,207,068 R62C probably damaging Het
Stat4 T C 1: 52,071,941 probably null Het
Tex9 A T 9: 72,480,595 probably null Het
Tsku T C 7: 98,352,831 T98A probably benign Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Vmn2r116 A C 17: 23,401,421 I710L probably benign Het
Vmn2r16 A T 5: 109,363,801 I625F probably damaging Het
Xpo4 G A 14: 57,591,022 Q794* probably null Het
Zfp112 T A 7: 24,125,048 I147N probably damaging Het
Zmiz1 T C 14: 25,636,010 S140P probably damaging Het
Other mutations in Asns
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Asns APN 6 7680179 missense probably damaging 1.00
IGL00656:Asns APN 6 7680215 unclassified probably benign
IGL01534:Asns APN 6 7675397 missense probably benign 0.03
IGL01996:Asns APN 6 7682378 missense possibly damaging 0.56
IGL02058:Asns APN 6 7685184 missense probably damaging 1.00
IGL02311:Asns APN 6 7676233 critical splice donor site probably null
IGL02367:Asns APN 6 7685411 splice site probably benign
IGL03263:Asns APN 6 7689404 missense probably benign 0.07
IGL03341:Asns APN 6 7682002 missense probably damaging 0.98
PIT4445001:Asns UTSW 6 7689277 missense probably damaging 1.00
R0034:Asns UTSW 6 7676299 missense probably damaging 1.00
R0034:Asns UTSW 6 7676299 missense probably damaging 1.00
R0050:Asns UTSW 6 7676019 missense probably benign 0.02
R0627:Asns UTSW 6 7675516 missense probably benign 0.05
R1075:Asns UTSW 6 7676076 nonsense probably null
R1591:Asns UTSW 6 7678007 missense probably damaging 0.97
R2047:Asns UTSW 6 7680093 missense probably damaging 0.99
R2232:Asns UTSW 6 7689316 missense possibly damaging 0.82
R2907:Asns UTSW 6 7675506 missense probably benign 0.03
R3907:Asns UTSW 6 7682270 critical splice donor site probably null
R4438:Asns UTSW 6 7675320 missense probably benign 0.15
R4660:Asns UTSW 6 7678012 missense probably benign 0.05
R4784:Asns UTSW 6 7678029 missense probably benign 0.12
R5655:Asns UTSW 6 7685309 missense probably benign 0.31
R5752:Asns UTSW 6 7689365 missense probably damaging 1.00
R5863:Asns UTSW 6 7675443 nonsense probably null
R5864:Asns UTSW 6 7675443 nonsense probably null
R5953:Asns UTSW 6 7682285 missense probably benign 0.00
R6773:Asns UTSW 6 7676284 missense probably benign 0.01
R6789:Asns UTSW 6 7675344 missense probably benign
R7389:Asns UTSW 6 7689291 missense probably damaging 1.00
R7524:Asns UTSW 6 7677259 synonymous probably null
R7783:Asns UTSW 6 7677978 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCCTCCGAAGTGCTTAGTG -3'
(R):5'- TGGATTGACAGCTTGTAGATGAC -3'

Sequencing Primer
(F):5'- CCTCCGAAGTGCTTAGTGTGAAAAC -3'
(R):5'- GACTTACAAATTTCCGATCCTTTTGG -3'
Posted On2015-07-06