Incidental Mutation 'R4373:Ercc1'
ID 326062
Institutional Source Beutler Lab
Gene Symbol Ercc1
Ensembl Gene ENSMUSG00000003549
Gene Name excision repair cross-complementing rodent repair deficiency, complementation group 1
Synonyms Ercc-1
MMRRC Submission 041675-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4373 (G1)
Quality Score 142
Status Validated
Chromosome 7
Chromosomal Location 19079016-19090449 bp(+) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) G to A at 19081057 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000135767 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003645] [ENSMUST00000160369] [ENSMUST00000161378] [ENSMUST00000176818]
AlphaFold P07903
Predicted Effect probably benign
Transcript: ENSMUST00000003645
SMART Domains Protein: ENSMUSP00000003645
Gene: ENSMUSG00000003549

DomainStartEndE-ValueType
low complexity region 68 79 N/A INTRINSIC
Pfam:Rad10 100 213 2.9e-55 PFAM
HhH1 269 288 4.04e0 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160192
Predicted Effect probably benign
Transcript: ENSMUST00000160369
SMART Domains Protein: ENSMUSP00000125655
Gene: ENSMUSG00000003549

DomainStartEndE-ValueType
low complexity region 68 79 N/A INTRINSIC
Pfam:Rad10 99 166 1.6e-34 PFAM
low complexity region 232 245 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160909
Predicted Effect unknown
Transcript: ENSMUST00000161378
AA Change: C52Y
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162992
Predicted Effect probably benign
Transcript: ENSMUST00000176818
SMART Domains Protein: ENSMUSP00000135767
Gene: ENSMUSG00000003549

DomainStartEndE-ValueType
Pfam:Rad10 23 90 8.4e-35 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207444
Predicted Effect noncoding transcript
Transcript: ENSMUST00000208263
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene functions in the nucleotide excision repair pathway, and is required for the repair of DNA lesions such as those induced by UV light or formed by electrophilic compounds including cisplatin. The encoded protein forms a heterodimer with the XPF endonuclease (also known as ERCC4), and the heterodimeric endonuclease catalyzes the 5' incision in the process of excising the DNA lesion. The heterodimeric endonuclease is also involved in recombinational DNA repair and in the repair of inter-strand crosslinks. Mutations in this gene result in cerebrooculofacioskeletal syndrome, and polymorphisms that alter expression of this gene may play a role in carcinogenesis. Multiple transcript variants encoding different isoforms have been found for this gene. The last exon of this gene overlaps with the CD3e molecule, epsilon associated protein gene on the opposite strand. [provided by RefSeq, Oct 2009]
PHENOTYPE: Nullizygous mutations result in growth and liver failure, nuclear anomalies and postnatal death, and may lead to spleen hypoplasia, altered isotype switching, B cell hypoproliferation, dystonia, ataxia, renal failure, sarcopenia, kyphosis, early replicative aging and sensitivity to oxidative stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adck5 A G 15: 76,478,535 (GRCm39) probably benign Het
Akr1b1 A C 6: 34,281,202 (GRCm39) probably benign Het
Armh4 T A 14: 50,007,893 (GRCm39) T527S probably damaging Het
Asns A T 6: 7,677,978 (GRCm39) S367T probably damaging Het
BC034090 T C 1: 155,101,904 (GRCm39) N120S probably benign Het
Bub1 A T 2: 127,647,156 (GRCm39) probably benign Het
Csf1 T A 3: 107,664,055 (GRCm39) T38S probably damaging Het
Ctsz T C 2: 174,270,378 (GRCm39) E268G possibly damaging Het
Dach1 G A 14: 98,065,186 (GRCm39) T685I possibly damaging Het
Dclre1a A G 19: 56,533,874 (GRCm39) L240S probably benign Het
Esam C T 9: 37,445,492 (GRCm39) T71I probably benign Het
Espl1 A G 15: 102,221,424 (GRCm39) I944V probably damaging Het
Gde1 A G 7: 118,297,781 (GRCm39) L35P possibly damaging Het
Gm10382 A G 5: 125,466,647 (GRCm39) probably benign Het
H2-M10.6 T C 17: 37,123,958 (GRCm39) Y141H probably damaging Het
Hk1 C A 10: 62,151,319 (GRCm39) K10N probably damaging Het
Lamc3 A G 2: 31,788,244 (GRCm39) K135E probably damaging Het
Lrtm2 A G 6: 119,297,489 (GRCm39) F184S probably damaging Het
Marchf11 A G 15: 26,309,532 (GRCm39) E62G probably damaging Het
Mtcl1 T A 17: 66,687,074 (GRCm39) T611S probably benign Het
Myc A T 15: 61,861,513 (GRCm39) H373L probably damaging Het
Myh6 T A 14: 55,199,565 (GRCm39) I249F probably damaging Het
Naaa T C 5: 92,426,002 (GRCm39) probably benign Het
Nfib A G 4: 82,241,895 (GRCm39) V432A probably damaging Het
Nmt1 A G 11: 102,934,026 (GRCm39) K55R probably damaging Het
Opa3 C T 7: 18,978,699 (GRCm39) R55W probably damaging Het
Or4c122 T C 2: 89,079,589 (GRCm39) R150G possibly damaging Het
Pfn4 T A 12: 4,820,182 (GRCm39) D10E probably damaging Het
Pld5 T A 1: 175,967,583 (GRCm39) I91F probably damaging Het
Plec A C 15: 76,067,317 (GRCm39) S1350A probably damaging Het
Polq G T 16: 36,833,543 (GRCm39) V79F probably damaging Het
Ppp1r16b T C 2: 158,603,685 (GRCm39) Y537H probably damaging Het
Prdm8 T C 5: 98,334,367 (GRCm39) S645P probably damaging Het
Rgs1 T C 1: 144,123,644 (GRCm39) T94A probably benign Het
Rpl11 G A 4: 135,778,454 (GRCm39) probably benign Het
Sanbr A T 11: 23,565,265 (GRCm39) probably null Het
Scamp3 G A 3: 89,089,234 (GRCm39) probably null Het
Sgsm1 TTTTATATT TTT 5: 113,405,989 (GRCm39) probably benign Het
Sirpb1b A T 3: 15,613,821 (GRCm39) I87K probably damaging Het
Slc14a2 G A 18: 78,250,283 (GRCm39) R62C probably damaging Het
Stat4 T C 1: 52,111,100 (GRCm39) probably null Het
Tex9 A T 9: 72,387,877 (GRCm39) probably null Het
Tsku T C 7: 98,002,038 (GRCm39) T98A probably benign Het
Ttc23l CT CTTGGATT 15: 10,537,648 (GRCm39) probably benign Het
Ttc23l G A 15: 10,537,652 (GRCm39) S206L probably benign Het
Vmn2r116 A C 17: 23,620,395 (GRCm39) I710L probably benign Het
Vmn2r16 A T 5: 109,511,667 (GRCm39) I625F probably damaging Het
Xpo4 G A 14: 57,828,479 (GRCm39) Q794* probably null Het
Zfp112 T A 7: 23,824,473 (GRCm39) I147N probably damaging Het
Zmiz1 T C 14: 25,636,434 (GRCm39) S140P probably damaging Het
Other mutations in Ercc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02929:Ercc1 APN 7 19,089,288 (GRCm39) critical splice donor site probably null
joyless UTSW 7 19,089,102 (GRCm39) splice site probably null
R2062:Ercc1 UTSW 7 19,088,295 (GRCm39) makesense probably null
R4374:Ercc1 UTSW 7 19,081,057 (GRCm39) unclassified probably benign
R4375:Ercc1 UTSW 7 19,081,057 (GRCm39) unclassified probably benign
R4852:Ercc1 UTSW 7 19,084,629 (GRCm39) missense probably damaging 1.00
R6000:Ercc1 UTSW 7 19,081,086 (GRCm39) unclassified probably benign
R6415:Ercc1 UTSW 7 19,089,102 (GRCm39) splice site probably null
R8113:Ercc1 UTSW 7 19,084,102 (GRCm39) missense probably damaging 1.00
R8369:Ercc1 UTSW 7 19,088,377 (GRCm39) nonsense probably null
R8557:Ercc1 UTSW 7 19,082,480 (GRCm39) missense probably benign 0.00
R8923:Ercc1 UTSW 7 19,081,062 (GRCm39) unclassified probably benign
R9566:Ercc1 UTSW 7 19,088,377 (GRCm39) nonsense probably null
X0057:Ercc1 UTSW 7 19,090,374 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGCTTAGGTGTCAGGCAC -3'
(R):5'- AAGCCATCTCTTCAGCCCTG -3'

Sequencing Primer
(F):5'- CTTCCCAAGTGCTAGGATCAAAGG -3'
(R):5'- GCCCTGGCTCATATATTTAATGC -3'
Posted On 2015-07-06