Incidental Mutation 'R4373:Zfp112'
ID326063
Institutional Source Beutler Lab
Gene Symbol Zfp112
Ensembl Gene ENSMUSG00000052675
Gene Namezinc finger protein 112
Synonyms
MMRRC Submission 041675-MU
Accession Numbers

Genbank: NM_021307; MGI: 1929115

Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R4373 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location24112314-24127952 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 24125048 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 147 (I147N)
Ref Sequence ENSEMBL: ENSMUSP00000150734 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005413] [ENSMUST00000120006] [ENSMUST00000215113]
Predicted Effect probably damaging
Transcript: ENSMUST00000005413
AA Change: I151N

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000005413
Gene: ENSMUSG00000052675
AA Change: I151N

DomainStartEndE-ValueType
KRAB 8 68 7.93e-27 SMART
low complexity region 385 397 N/A INTRINSIC
ZnF_C2H2 523 545 4.11e-2 SMART
ZnF_C2H2 551 573 3.44e-4 SMART
ZnF_C2H2 579 601 1.6e-4 SMART
ZnF_C2H2 607 629 1.5e-4 SMART
ZnF_C2H2 635 657 3.89e-3 SMART
ZnF_C2H2 663 685 1.58e-3 SMART
ZnF_C2H2 691 713 6.42e-4 SMART
ZnF_C2H2 719 741 5.99e-4 SMART
ZnF_C2H2 747 769 7.78e-3 SMART
ZnF_C2H2 775 797 3.95e-4 SMART
ZnF_C2H2 803 825 2.01e-5 SMART
ZnF_C2H2 831 853 1.36e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120006
AA Change: I145N

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113031
Gene: ENSMUSG00000052675
AA Change: I145N

DomainStartEndE-ValueType
KRAB 2 62 7.93e-27 SMART
low complexity region 379 391 N/A INTRINSIC
ZnF_C2H2 517 539 4.11e-2 SMART
ZnF_C2H2 545 567 3.44e-4 SMART
ZnF_C2H2 573 595 1.6e-4 SMART
ZnF_C2H2 601 623 1.5e-4 SMART
ZnF_C2H2 629 651 3.89e-3 SMART
ZnF_C2H2 657 679 1.58e-3 SMART
ZnF_C2H2 685 707 6.42e-4 SMART
ZnF_C2H2 713 735 5.99e-4 SMART
ZnF_C2H2 741 763 7.78e-3 SMART
ZnF_C2H2 769 791 3.95e-4 SMART
ZnF_C2H2 797 819 2.01e-5 SMART
ZnF_C2H2 825 847 1.36e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000215113
AA Change: I147N

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Meta Mutation Damage Score 0.1080 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 98% (54/55)
Allele List at MGI

All alleles(1) : Gene trapped(1)

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A T 11: 23,615,265 probably null Het
3632451O06Rik T A 14: 49,770,436 T527S probably damaging Het
Adck5 A G 15: 76,594,335 probably benign Het
Akr1b3 A C 6: 34,304,267 probably benign Het
Asns A T 6: 7,677,978 S367T probably damaging Het
BC034090 T C 1: 155,226,158 N120S probably benign Het
Bub1 A T 2: 127,805,236 probably benign Het
Csf1 T A 3: 107,756,739 T38S probably damaging Het
Ctsz T C 2: 174,428,585 E268G possibly damaging Het
Dach1 G A 14: 97,827,750 T685I possibly damaging Het
Dclre1a A G 19: 56,545,442 L240S probably benign Het
Ercc1 G A 7: 19,347,132 probably benign Het
Esam C T 9: 37,534,196 T71I probably benign Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Gde1 A G 7: 118,698,558 L35P possibly damaging Het
Gm10382 A G 5: 125,389,583 probably benign Het
H2-M10.6 T C 17: 36,813,066 Y141H probably damaging Het
Hk1 C A 10: 62,315,540 K10N probably damaging Het
Lamc3 A G 2: 31,898,232 K135E probably damaging Het
Lrtm2 A G 6: 119,320,528 F184S probably damaging Het
March11 A G 15: 26,309,446 E62G probably damaging Het
Mtcl1 T A 17: 66,380,079 T611S probably benign Het
Myc A T 15: 61,989,664 H373L probably damaging Het
Myh6 T A 14: 54,962,108 I249F probably damaging Het
Naaa T C 5: 92,278,143 probably benign Het
Nfib A G 4: 82,323,658 V432A probably damaging Het
Nmt1 A G 11: 103,043,200 K55R probably damaging Het
Olfr1228 T C 2: 89,249,245 R150G possibly damaging Het
Opa3 C T 7: 19,244,774 R55W probably damaging Het
Pfn4 T A 12: 4,770,182 D10E probably damaging Het
Pld5 T A 1: 176,140,017 I91F probably damaging Het
Plec A C 15: 76,183,117 S1350A probably damaging Het
Polq G T 16: 37,013,181 V79F probably damaging Het
Ppp1r16b T C 2: 158,761,765 Y537H probably damaging Het
Prdm8 T C 5: 98,186,508 S645P probably damaging Het
Rgs1 T C 1: 144,247,906 T94A probably benign Het
Rpl11 G A 4: 136,051,143 probably benign Het
Scamp3 G A 3: 89,181,927 probably null Het
Sgsm1 TTTTATATT TTT 5: 113,258,123 probably benign Het
Sirpb1b A T 3: 15,548,761 I87K probably damaging Het
Slc14a2 G A 18: 78,207,068 R62C probably damaging Het
Stat4 T C 1: 52,071,941 probably null Het
Tex9 A T 9: 72,480,595 probably null Het
Tsku T C 7: 98,352,831 T98A probably benign Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Vmn2r116 A C 17: 23,401,421 I710L probably benign Het
Vmn2r16 A T 5: 109,363,801 I625F probably damaging Het
Xpo4 G A 14: 57,591,022 Q794* probably null Het
Zmiz1 T C 14: 25,636,010 S140P probably damaging Het
Other mutations in Zfp112
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00094:Zfp112 APN 7 24122243 missense probably damaging 1.00
IGL00575:Zfp112 APN 7 24126332 missense probably damaging 1.00
IGL00944:Zfp112 APN 7 24125596 missense probably benign 0.02
IGL01662:Zfp112 APN 7 24125954 missense probably benign 0.44
IGL03383:Zfp112 APN 7 24125678 missense probably damaging 1.00
2107:Zfp112 UTSW 7 24126841 missense probably damaging 1.00
FR4737:Zfp112 UTSW 7 24125407 small insertion probably benign
R0566:Zfp112 UTSW 7 24125677 missense probably benign 0.09
R0581:Zfp112 UTSW 7 24125863 missense probably damaging 0.97
R0613:Zfp112 UTSW 7 24127028 missense probably benign 0.33
R1521:Zfp112 UTSW 7 24125785 missense probably damaging 0.97
R1614:Zfp112 UTSW 7 24126599 missense probably damaging 1.00
R1827:Zfp112 UTSW 7 24124960 missense probably damaging 1.00
R1906:Zfp112 UTSW 7 24122295 missense probably benign 0.34
R1920:Zfp112 UTSW 7 24125237 missense probably benign 0.01
R2008:Zfp112 UTSW 7 24126751 missense probably damaging 1.00
R2012:Zfp112 UTSW 7 24125300 missense possibly damaging 0.69
R2192:Zfp112 UTSW 7 24125438 missense probably damaging 0.98
R2985:Zfp112 UTSW 7 24122295 missense probably benign 0.34
R4191:Zfp112 UTSW 7 24126143 missense probably benign 0.19
R4374:Zfp112 UTSW 7 24126373 missense probably damaging 1.00
R4674:Zfp112 UTSW 7 24126974 missense probably damaging 1.00
R4676:Zfp112 UTSW 7 24126260 missense probably damaging 0.97
R5023:Zfp112 UTSW 7 24126484 missense probably damaging 0.99
R5198:Zfp112 UTSW 7 24124856 missense possibly damaging 0.49
R6559:Zfp112 UTSW 7 24126463 nonsense probably null
R6835:Zfp112 UTSW 7 24125806 missense probably damaging 1.00
R6946:Zfp112 UTSW 7 24125341 missense probably damaging 0.98
R7263:Zfp112 UTSW 7 24125527 missense probably benign 0.04
R7512:Zfp112 UTSW 7 24125179 missense possibly damaging 0.73
R7533:Zfp112 UTSW 7 24125327 missense possibly damaging 0.58
R7535:Zfp112 UTSW 7 24126710 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGAAGTAAACTCCCTTTGTCCC -3'
(R):5'- TAGCTCCTCATTGTCACTGTGG -3'

Sequencing Primer
(F):5'- GTCCCGAGGACCTCTCC -3'
(R):5'- CTGCCATACCTACAGAAGTGATTTC -3'
Posted On2015-07-06